Skip to playerSkip to main content
  • 7 months ago

Category

📺
TV
Transcript
00:01Previously on America's Next Top Model, Michelle's erratic behavior confused her roommate.
00:07I just don't, don't do it again, and I'll be fine.
00:11Yuvi photographed like a cold fish.
00:14It's the worst photo in the history of America's Next Top Model.
00:18But in the end, the judges couldn't see past Brandi's attitude.
00:22Eleven girls remain, who will be eliminated tonight.
00:30AKU YEEZ havoc
00:35忘agtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagtagt sarkkt
00:42Affiliate int mercy.
00:46u kanwirandha
00:53NAが今回のリ scholarshipsがますが
00:56It's kind of weird that Brandy's gone, though.
01:07Very, very weird.
01:09I think it's great.
01:11Oh, yeah.
01:12Yesterday at Elimination, I was just thinking, all right, I'm going home.
01:17It's the worst photo in the history of America's next top model.
01:21To hear that it's the worst picture, I feel like I have more pressure.
01:25I have the worst picture in America's next top model history.
01:28Holy camole, I'm that girl.
01:30I can't believe that.
01:33Michelle's like the girl that stays to herself and doesn't try to fit in or doesn't try to, you know, make conversation or make friends.
01:40Her personality is so much different than the other girls.
01:42This morning, I have a couple spots on my face that are actually breaking out.
01:46And they look like little, like burn circle things.
01:49I've never had this happen before, so I have no idea what it is.
01:53How do you get things like that on your face?
01:55I don't know what's going on with Michelle's face.
01:57She says she just wakes up with these sores.
01:59So maybe she hurts herself to make herself feel better.
02:02Witchcraft or...
02:03I was like, um...
02:04Do you, like, worship the devil?
02:06She's got scabs that big on her head.
02:08Ty!
02:10What?
02:11Ty!
02:11Ty!
02:12Ty!
02:12Ty!
02:12Ty!
02:12Ty!
02:12Ty!
02:12Ty!
02:12Ty!
02:13Ty!
02:13Ty!
02:13Ty!
02:14Ty!
02:14Ty!
02:15Ty!
02:15Ty!
02:16Ty!
02:16Ty!
02:17Ty!
02:18Ty!
02:19Ty!
02:20Ty!
02:21Ty!
02:22Ty!
02:23Ty!
02:24Ty!
02:25Ty!
02:26Ty!
02:27Ty!
02:28Ty!
02:29Ty!
02:30Ty!
02:31Ty!
02:32Ty!
02:33Ty!
02:34Ty!
02:35Ty!
02:36Ty!
02:37Ty!
02:38Ty!
02:39Ty!
02:40Ty!
02:41Ty!
02:42Ty!
02:43Ty!
02:44Ty!
02:45Ty!
02:46Ty!
02:47Ty!
02:48Ty!
02:49Ty!
02:50And he started talking.
02:52My name's Paul Thompson, and I'm an instructor here at the Makeup Design Array today.
02:57This is my assistant, John.
02:59We're going to do about a three-hour class in beauty makeup.
03:02We're like, wait a minute.
03:04This can't be the guy that's going to teach us.
03:07Lip pencil.
03:09Lip pencil can save your lips.
03:12Excuse me.
03:13Don't talk to her in my class.
03:16Thank you very much.
03:18Foundation.
03:19We're just bored out of our minds, ready to fall asleep at any second.
03:23Um, y'all better work it, girls.
03:29Work!
03:34I didn't expect it to be Mr. J.
03:36I would've even expected it to be tired before I was him.
03:39This is the real Paul Thompson, guys.
03:41Paul is the director of education here at the Makeup Artist Design Array,
03:44and Paul is actually responsible for this makeover today.
03:48We did this to illustrate the power that makeup truly has to transform you girls.
03:55I think the reason that Mr. J Dress Up is to show the rest of us that even though Michelle has scabies,
04:00she can still be beautiful.
04:01So first, I want you guys all to pick a partner really quickly.
04:06Who here can tell me what's a go-see?
04:08Uh, a go-see is when you go to a client or a designer and you show them, you know, your runway walk and your portfolio.
04:15Okay, that's pretty close.
04:16Good.
04:17It's really important when you guys walk in to see a client to look natural.
04:23What I want you guys to do in pairs, I want you to do a go-see look on each other.
04:28We've got some covergirl makeup sitting out here.
04:32I want you guys to create a clean, fresh, natural look using covergirl makeup.
04:36I'm going to go get this stuff off my face.
04:39Good luck.
04:40Let's do it.
04:44Classic or ivory?
04:45Do you want to make it look like a clown?
04:46I like you with a purple.
04:47I'm going to look and see if these girls really understand the fact that they need to look clean, fresh, and natural.
04:52I mean, there's a whole lot of makeup on that table.
04:53They have to look like they're not made up.
04:55When I'm applying makeup to myself, I believe that I'm very good at it.
04:59However, being forced to figure out how to work with someone else's face is a lot more complicated.
05:04It's not that bad.
05:05I want to cover that up and cover that up.
05:07I actually have two partners, Tiffany and Yubin.
05:09You guys cover it with like blush or something?
05:11Yeah.
05:11I felt really horrible because they were trying to hide the spots on my face.
05:16A little bit more blush.
05:17And you are good to go.
05:19Look pretty.
05:19And they're like, oh, it's okay.
05:20You're beautiful.
05:21My face is falling off.
05:23How can I be happy about that?
05:25I don't know even how to do makeup.
05:27So just try it.
05:28We both, come on.
05:29Teamwork, teamwork.
05:30No, just keep going.
05:32Okay, just calm down.
05:33Michelle is always just like in this competitive mode.
05:36And my dad used to have these little things that come up on his skin because he would be too stressed out.
05:40So, Michelle, you know, maybe you just need to relax.
05:43What's wrong?
05:44Chill.
05:45I just suck at makeup.
05:47She flipped out about the makeup.
05:49And I didn't know how to do makeup.
05:50Yubi really didn't know how to do makeup, you know, but we were having fun.
05:53I hate it when I don't have to do stuff.
05:55She just says that she's just a perfectionist and she's just so hard on herself.
05:59But something's wrong.
06:00The real point of today's lesson was all about that natural, fresh look.
06:06Yubi, you actually look great.
06:08I do that.
06:09Oh, okay, Tiffany.
06:10You get two points for that one.
06:12Okay, Michelle.
06:13Oh, and Michelle, okay.
06:16You look fresh, you look natural, you look soft.
06:18And that's really important.
06:20Oh, well, your base is too pale and your lips are too pale.
06:23So you actually look like a little sick.
06:25The only chance I really get to keep up with fashion and to learn about it is through magazines during my lunch break at work.
06:31Because at home, I'm taking care of my son.
06:34So, a little out of my element.
06:36Okay, who did your makeup?
06:37Christina.
06:38Did you use the True Blend?
06:39No, I didn't use any foundation on her.
06:41We went for the natural look.
06:42We just put a little bit of concealer on her.
06:44But natural needs help.
06:46So what's our lesson of the day?
06:47Like, go see makeup?
06:48It's makeup that doesn't look like what?
06:50Like makeup.
06:51Exactly.
06:58Michelle, it's all the time to get the hell out of me.
07:01It's just, I'm a perfectionist and I, like, kick myself all the time.
07:06Every time there's some kind of activity to do, she always beats herself up about it.
07:10And now her face is starting to get worse and it's starting to feel worse and she's starting to feel ugly.
07:17Ooh, it's getting worse.
07:18It is, it is.
07:19It looks gross.
07:20I've always wanted to feel, you know, gorgeous and beautiful.
07:24But then I'll go and look in the mirror and it's like, my nose is too big.
07:27My skin's not, you know, healthy.
07:29And looking at everyone else around me, I look nothing like them.
07:43I missed you so, so much.
07:45And I'm coming home very, very soon, I promise.
07:48My son Damien means, like, everything.
07:51It's really like an indescribable feeling, I guess, when you feel like you're missing literally a part of yourself.
07:56Once you have a baby, it's not just my life anymore, you know.
08:00It's like, I don't just do all this stuff for myself.
08:01I do it for the better life of my child.
08:04Noelle talks constantly about her child 24-7.
08:08It's like, okay, we got it.
08:09You have a kid.
08:10Next.
08:13Woo!
08:15Hi!
08:16Hi, I'm here.
08:17Hi!
08:18Hi, I'm here.
08:19Hi, I'm here.
08:20Hi, I'm here.
08:21Hi, I'm here.
08:22Sit down, everybody.
08:23Hi!
08:24You guys going through a lot of stress?
08:25Yeah.
08:26Yeah.
08:27Especially when I stand up every week and you don't know if I'm going to call your name, right?
08:28Yeah.
08:29Yeah.
08:30Yvi and I were talking about how if we put all the stressful moments of everything we've been through
08:31in the past together in one day, it'd be less stressful than how we go through every day.
08:34Really?
08:35So what we're going to do is I'm going to take you guys one by one and we're going to be able to talk.
08:40Okay.
08:41All right?
08:42Sorry, this is still very weird for me.
08:45What's weird?
08:46That I'm talking to you.
08:47Really?
08:48I'm like, I can't believe it.
08:50I guess it's real.
08:51I'm real.
08:52Hi.
08:53Hi.
08:54Anything you want to talk to me about?
08:55Yeah.
08:56Yeah.
08:57Yeah.
08:58Yeah.
08:59Yeah.
09:00I have a lot, but my mind just has a...
09:03Is it blank?
09:04It has a brain muffin.
09:05Yeah.
09:06I know my bad points, which is weird for me because I'm not fixing them and I know I need
09:10to.
09:11Your face is such an interesting face, but it's a face that has to be very careful how it
09:15photographs.
09:16Because you have such a beautiful, heavy eye, but if not held right, it can be like...
09:19But if held right, it's POW!
09:22How are you handling the pressure of being in this competition?
09:26I don't know whether it's like the stress or the makeup, but like these little things on
09:30my face and...
09:31See?
09:32I don't know if that's like the stress that's kind of scaring me.
09:35I don't think that's stress or makeup, Michelle.
09:37Yeah, I'm...
09:38I've had skin problems too.
09:39Like I've had warts as a little girl.
09:40I used to get these like black patches on the left side of my thigh that I used to have
09:43to get burned off, but I've never seen anything like that.
09:45Are you going to see a dermatologist?
09:46Are we getting that for you?
09:47Yeah.
09:48Hi.
09:49Hey.
09:50How are you doing?
09:51You know, I don't know.
09:53You know I don't know.
09:54I just feel like I don't really fit in here.
09:57I want to be a model.
09:58Lord knows I do.
09:59But sometimes I may not know what a certain word means or like a lot of times we'll go
10:03out to eat and I'm just sitting there in the blue.
10:05Like the menus might have things like foie gras and smoked salmon with creme fraiche and
10:09you're like, what the heck is that?
10:10Exactly.
10:11Well Tiffany, I was just like you.
10:12I didn't know what that stuff was when I first started modeling.
10:15It's okay to ask questions.
10:16It's just a lot going on in my body and just being here and just thinking about her.
10:22I feel like I have nobody here.
10:25But I think if you open your horizons, a lot of it is fear.
10:28You know, fear of something that's different.
10:30And I bet some of these girls have a similar experience to you.
10:33Back home, like, I don't really like have a house that I'm staying at.
10:38I just kind of am like staying on my friends' couches and stuff because I had a house with
10:43my sister and then she kicked me out.
10:45And she took all my money from me.
10:47And my mom, she stays with her boyfriend so I basically was sleeping on the beach sometimes.
10:51Well I say just stay strong.
10:53Just keep your eye on the prize.
10:55You have a lot to gain.
10:57I'm having like the worst case of separation anxiety I think I've ever had.
11:01It's so hard, like especially like when I hear Damien on the other end of the phone.
11:05Maho, Maho.
11:06I'm like, you don't understand, baby.
11:09Mama's doing this for a good reason.
11:11I never got to do anything for myself.
11:13I mean, I'm only 20.
11:14You know, I'm not having a baby.
11:15You give that life up because he deserves that.
11:17The industry now is so different.
11:19Before it was like you had a baby.
11:20Career's over.
11:21Now models are popping them out like rabbits are popping them out.
11:24Yeah.
11:25And you can bring that baby to work.
11:27Definitely okay now.
11:28Well give me a hug.
11:29Oh my gosh.
11:36You've all had good and bad critiques.
11:39See if you can make up the difference.
11:42Be ready at 7am.
11:44Woo!
11:457am.
11:467am.
11:47Good morning.
11:48So we're here at the salon at Beverly Hills.
12:02What did we do yesterday?
12:04Make up.
12:05A clean, fresh, natural look.
12:08But we're not going to do that today.
12:10Does anyone here know what haute couture is?
12:12Oh my God.
12:15You girls want to be fashion models.
12:17You got to know what this is.
12:18Well, haute couture is just high fashion runway makeup.
12:21Very elaborate and very fashionable.
12:23And not looking common.
12:24So today we're going to put you girls to the test.
12:27And the challenge is to create an haute couture makeup look.
12:31I have five makeup stations set up in the room over there.
12:34Foundation.
12:35Blush and eyeshadow.
12:37Mascara and eyeliner.
12:39Accessories.
12:40And lipstick.
12:41You get 45 seconds at each station.
12:44What I'm going to be judging you guys on is your creativity and originality.
12:50The winner and two friends get a custom-made, one-of-a-kind item from a designer.
12:56Alright.
12:57So let's go.
12:58This is going to be interesting.
13:01I'm definitely worried about the whole skin aspect.
13:04This is a modeling competition and, I mean, looks do count and just kind of freaking out a bit.
13:10Okay, go.
13:11I was going to watch everyone else do their makeup and, you know, pick up a few pointers, but I was the very first one to go.
13:18Six seconds.
13:19Oh, you're serious.
13:20Change stations, girls.
13:21Change.
13:22Change.
13:23Change.
13:24Had I been given 46 seconds, it might have been different, but that 45 just really killed
13:32me.
13:33You got 10 seconds.
13:34Stop.
13:35Okay, that's the way I'm going to go.
13:36Okay, that was my turn.
13:37Stop.
13:38Change.
13:39Next station.
13:40I've got a blue eye.
13:41Change.
13:42I thought I did really awesome, but then I sat there and started watching the other girls,
13:50and I was like, damn, they're doing good.
13:52Alright, you're done.
13:54You know what?
13:55This was an experience for me.
13:59I'm going to start with you, Becca.
14:00You look like an everyday mall girl.
14:03Okay, Brittany, looks kind of fashion-y.
14:05I'm going to give you points for that.
14:06Tiffany, you look like a toasted Miss Piggy on crack.
14:09Noelle, you need to stay away from that blue.
14:12You look like those little girls that run to the mall and go, oh, I got a little glitter.
14:15I got a little star in my eye.
14:16I do.
14:17I have no clue what hauteure is.
14:18Not because I don't watch anything, but it's very hard to pay attention to a runway
14:23show on TV when your son's turning the TV off every three seconds.
14:27Yuvi, you look like Daisy Duke.
14:29You picked up lashes.
14:30Girl, you got so many lashes anyway.
14:33Michelle, I don't know.
14:35I know you were trying to save with the glitter at the end, but it's a little more fright
14:40night.
14:41I just beat myself up over that because no matter what I do, there's something I could
14:45have done better.
14:46Come up here, Naima.
14:48This is eau couture.
14:49I don't know what it was.
14:50I was inspired by like Swan Lake or something.
14:54Creativity, high fashion.
14:55You got to give it up to you or great.
14:58All right.
14:59So now you get to pick two friends to share your prize with you.
15:03Yuvi and Christina.
15:12After that challenge, I realized that this was spreading on my face.
15:16My face is getting worse and I don't know what to do with it.
15:18It looks horrible.
15:19Then I'm getting another one on my chin and another one below this one.
15:22See the red little burn thing that looks like it?
15:25That's how the other two started out.
15:26Look, let me see.
15:27No.
15:28It looks horrible.
15:30Lauren's the prize.
15:35Jay tells us you get to go to a designer and they're going to make you a one of a kind
15:40piece.
15:41Hi, I'm Lauren Scher and welcome to my studio.
15:44The reason why I'm here today is to custom make your own handbag.
15:49May I get this black with the pendant?
15:52Yes.
15:53Of course.
15:54Lauren's work is so great.
15:55It's hard to decide what you want.
15:56It's going to be a one of a kind that no one else is going to have.
15:59Every girl's drink.
16:06Did I tell you?
16:07One of the girls got a flesh eating bacteria on her face.
16:10Oh, you know what?
16:12Let me just tell you.
16:13That's been all over the news.
16:15There is some straight bacteria that is resistant to antibiotics.
16:20It looks like her skin is peeling off.
16:23Well, I'm just telling you, well, it's serious.
16:25You can get pneumonia and die from the pneumonia.
16:28I don't know.
16:29Yeah.
16:30Oh, you know that there's a bacteria that's eating away at the skin.
16:33What?
16:34It's been all over the news.
16:35Someone has died from it already.
16:36I was like, no, seriously.
16:37What?
16:38What is it?
16:39I'm flipping out because I don't want anything to eat my skin.
16:43You know, I love my skin.
16:44It's been all over the news.
16:45There is a bacteria that is uncurable by antibiotics.
16:50Someone's already died from it.
16:52Hey!
16:53Uh-uh.
16:54Yubi!
16:55It's been all over the news.
16:56My mom said it's been on every major news station.
16:57What?
16:58In here.
16:59I haven't told her about Michelle.
17:00My mom found this.
17:01My mom just told me off the hand.
17:02She didn't tell her.
17:03You didn't even tell her about Michelle?
17:04I told her afterward.
17:05Did you decide to use the stain makeup?
17:09You did.
17:10Ugh.
17:11You guys now, gosh.
17:13I'm gonna die.
17:15Have you been hearing anything about this skin disease that's spreading around and, like,
17:28is incurable?
17:29Yeah, I have.
17:30You have.
17:31That stuff that that girl has kills people in probably one of her.
17:34in probably one of the most disgusting manners.
17:37Yeah, I know.
17:38There's this new flesh-eating bacteria thing
17:40that people have been dying from.
17:43Remember watching 2020 and they said
17:44there's more germs on the telephone
17:46than there's a toilet?
17:49And it's flesh-eating.
17:51And she says, on her hips, it's on her back.
17:53On her hips?
17:54Shh, she's gonna kill us.
17:58I kept going into Michelle's room,
18:00peeping to make sure her face
18:01wasn't falling off on the pillows.
18:04Shh, she doesn't breathe when she's sleeping.
18:08I just feel too peachy keen right now.
18:11People don't want to be around that.
18:12We're scared that she's gonna touch her face
18:14or then touch something and us touch it.
18:16Ah!
18:18Come on.
18:19Yeah?
18:19Did you hear the news about some kind of disease
18:22that eats your skin?
18:23Uh-uh.
18:24Oh, you sure? You ain't hear nothing about it?
18:26Uh-uh.
18:26Y'all just need to get a light.
18:28We need to get a light.
18:30Y'all ain't got nothing to do.
18:31Read a book or something.
18:34Tyra Mell.
18:35Tyra Mell.
18:36There are 11 of you left.
18:3810 more to go.
18:39The race is on.
18:40Be ready to show your true colors
18:42at 7 o'clock in the morning.
18:45Tyra.
18:50Good morning.
18:51Good morning.
18:52You guys all excited today?
18:53Yes.
18:53You got energy?
18:54Yes.
18:55Good.
18:56This week we've learned all about makeup
18:58and the power that it has to transform people.
19:00So today, you guys are all going to have mustaches.
19:03Oh!
19:04What?
19:05Milk mustaches.
19:06Oh!
19:06Oh!
19:08We are doing this shoot for Got Milk.
19:11And you know, Tyra's done the Got Milk campaign twice.
19:14So this is Geeta and this is Delilah.
19:16Bye.
19:17Bye.
19:17They're going to be your photographic team.
19:19Now there's a twist.
19:21We are actually going to switch your ethnicities.
19:25The challenge here really is taking on the persona
19:29of that other ethnicity while in the photograph
19:32and owning it.
19:35Christina, you're going to be an East Indian.
19:38Tiffany, you're going to be Native American.
19:40Brittany, an African-American woman.
19:43Kenya, Korean.
19:46Katelyn, we're featuring yours on the line.
19:49Michelle, an Eskimo woman.
19:52Naima's going to be an Icelandic Scandinavian.
19:55Tatiana, a biracial woman.
19:57Wow.
19:57Yuvi, a Swedish milkmaid.
19:59Wow.
20:00Becca, a really dark, tanned, Italian, Sicilian woman.
20:04And Noelle, we're making you into a traditionally African woman
20:08with a head wrap and everything.
20:09Wow.
20:10I'm half black.
20:15So being transformed into a proud African woman for me
20:19is definitely an exciting experience.
20:23So, of course, you know, we can't always make it easy, easy, easy, right?
20:27Right.
20:28You guys are going to be posing with someone.
20:31You want to meet who you're posing with?
20:33Yes.
20:34Come out here, Jared.
20:35Come here.
20:36Oh.
20:37This is Jared.
20:38Hi, Jared.
20:39Wave.
20:41All you girls are going to have a little three-year-old with you in your shot.
20:45I'm excited because I love children.
20:48Obviously, I'm a mom.
20:50But it's just making it that much harder to be away from Damien.
20:54I feel really bad for Michelle that she's got splotches of her face just peeling off.
20:58I know that must be really hard, but at the same time, I would never want her to have her child in her arms.
21:04I was worried, really, really worried.
21:07And some of the other girls are like, oh, my God, you need to go get that chick.
21:10I'm a bit worried about putting makeup on all of that.
21:14I'm going to talk to Jared about it.
21:15Okay, thank you.
21:16I'm sure there's like, it's not going to be a shit.
21:17Because I'm like, does someone know voodoo in the house?
21:19Did you find any chicken bones laying around?
21:21But she's bleeding up here now.
21:23Yeah.
21:24I'm not putting makeup over because it could be leprosy.
21:26These girls are under a lot of stress.
21:27It looks like it could be stress-related, but I'm not a doctor.
21:32So let's just try and get her to the doctor today, then.
21:34I was kind of freaking out because I did have to leave the photo shoot.
21:38And I didn't want to, you know, be gone for hours and hours.
21:40And then come back and everyone would be done.
21:43You ready, Kenya?
21:44I sure am.
21:49Nice.
21:49It's not about comfort.
21:53It's about the look.
21:55Having a deal with this little person, it's very challenging and very difficult.
21:58And he just didn't want to cooperate.
22:00Look over there.
22:00Look, it's a bird.
22:02There's your own little way of working them out.
22:06High five.
22:07Hi.
22:08Hi, my mom.
22:10Hi, honey.
22:11What's your name?
22:12My father is black and Mexican-Indian.
22:16And my mom is black and Irish.
22:18To be made up as a white woman.
22:22It's a little mind-blowing.
22:24It just goes to show you're ultimately defined by who you are, not by this outside.
22:29You have such expressive eyes.
22:33You're just sort of the perfect, like, blunt milk.
22:35I was born in Mexico.
22:36But now I'm going to be a blonde Swedish girl.
22:39I'm happy that I'm actually going to be a person and not a fish or not an alien.
22:44I can do this.
22:45Are you ready?
22:46I'm ready.
22:48Mouth closed.
22:50You'll be looking at me.
22:51And, uh, see what I'm in.
22:53You'll be let herself get a little distracted by the child.
22:57Close your mouth.
22:59You all right?
23:00Yeah, I'm just slipping.
23:02You are slipping.
23:03Mouth closed.
23:04Hi, Jared.
23:06Is it Jared?
23:07It's Jared.
23:08Oh, my baby name is Chadrick.
23:12She's cute.
23:13Tiffany Noel might have a small advantage just because they're used to holding a child on
23:17their arm.
23:17But I know that they're also having a really hard time seeing all these children around,
23:21and their children aren't there.
23:22Are you excited to be playing with these kids?
23:25Oh, my God.
23:26I'm going to start crying.
23:27I'm excited, but at the same time, it's going to be a lot harder.
23:30How can I allow myself to be affectionate and have a connection with this child I'm working
23:34with when I can't even be at home with my own son?
23:38Oh, hi.
23:41Hold on.
23:41Your daddy's right there, sweetie.
23:42He's not leaving.
23:44Give her a hug, Austin.
23:45Can we smile at the man with the pretty camera?
23:48Austin definitely reminded me of Damien.
23:50I about broke down.
23:51I tried so hard not to cry.
23:53It was definitely really hard.
24:00So you have something on your face that you may look at.
24:02Yes, I have no idea what it is.
24:06Have you ever heard of impetigo?
24:08No.
24:08It's usually caused by bacteria, and it's easily treatable.
24:12It probably will go away fairly quickly.
24:14I am extremely relieved because I found out, like, my face isn't falling off, and it's curable
24:19and everything.
24:20If I'm, like, around other people, is there a possibility that I would give it to them,
24:25or...
24:25Only for contact.
24:26It is kind of contagious, so I was kind of worried about some of the other girls.
24:30I'm a black girl with a nose job.
24:32Come on.
24:32You're a Jackson.
24:33It's a tight little cute friend.
24:35You got milk?
24:36Oh, you got milk?
24:38I got you, sweetie.
24:39I got you.
24:40You're not gonna go.
24:40Couple more.
24:42Brittany, best shoot to date.
24:44So, it'll clear up.
24:48It's a bacterial infection or whatever, and they gave me pills and cream and stuff.
24:52Now that I know that she has infant take-o, I feel like we did get a little out of control,
24:57and that we made it seem bigger than it actually is.
25:00So, Tatiana, you're facing a little up.
25:03Go sleepy bye-bye on her cheek.
25:05The kid was frickin' heavy.
25:07Kids are not my thing.
25:10Go over this way.
25:13Christina, regal, not cold.
25:17You're falling.
25:17You're falling?
25:18I won't let you fall, I promise.
25:20That challenge was for us to be able to maintain a live crop.
25:24There goes your veil.
25:25Pulling on the back.
25:26And a heavy one at that, basically.
25:28Those kids are healthy.
25:30We have to just be careful with the kids.
25:32Oh, I understand.
25:33So, what we did is we got a little doll.
25:34You need to bond with your child.
25:36Michelle is going to have it easy with no weight on her baby.
25:40It's not going to be heavy like the rest of them.
25:41She can move around, she can feel free, and her whole body is relaxed,
25:44where the rest of us are tense with a 40-pound child on her hip.
25:47Down a little bit and put your arm in a little bit.
25:50I love you.
25:50She kept laying down, and my arms are not very strong whatsoever.
25:55It's a workout, isn't it?
25:58It is going to be uncomfortable, just as a warning.
26:01And a little island girl smile, just with your eyes, you know?
26:06Caitlin definitely struggled today, because the child was very, very heavy.
26:10So, you saw this pained expression on her face.
26:15Oh, this is unfair.
26:18Her face is falling off.
26:19Back off.
26:21Yeah, but you done put it back on, then, son.
26:23Well, maybe she's just prettier than you.
26:25It's a theory.
26:26I'm glad you laughed.
26:29Come on.
26:29Let's be realistic.
26:30Since you have the easiest job, you better put the best faces.
26:34What's the baby's name?
26:35I think they named it Cletus.
26:37The doll is obviously lighter than the three-year-old child,
26:40but at the same time, the doll doesn't respond like a child does.
26:43I think it's a little more difficult.
26:44You did one frame where you kind of were looking at the child,
26:47then you look off.
26:48One, two, three.
26:50Yeah, we got it.
26:51We got it.
26:52Bye!
26:52Tomorrow you'll meet with the judges.
27:04Only ten of you will continue in the hopes of becoming America's next top model.
27:08One of you will be eliminated.
27:10If I'm the last two again this week, I will freak out.
27:15I'm definitely worried.
27:16If I get eliminated because the whole skin thing, I'd be pissed off.
27:22Hi, everybody.
27:32Hi.
27:33Now it's time to make our fourth cut,
27:35which will bring us one step closer towards determining
27:38who will become America's next top model.
27:42Now, of course, you guys know we have some amazing prizes.
27:44The first is a contract with top international model management company, Ford Models,
27:51a spread in Elle magazine, which will be shot by a world-renowned photographer.
27:55Who, Janice?
27:55Gilles Ben-Simon.
27:57Oui, oui.
27:57And a $100,000 contract with CoverGirl Cosmetics.
28:03So now, of course, you guys know we have a crazy panel of judges,
28:06starting with...
28:07Janice Dickinson, one of the world's first supermodels.
28:10Nigel Barker, a noted fashion photographer.
28:12Nolay Marin, prominent fashion editor and stylist.
28:16And does our special guest judge look familiar to you all?
28:18Yes.
28:19Mr. Jim DeYonker.
28:21Jim is the producer of all of your photo shoots.
28:24So now it's time for your evaluations.
28:26Then the judges will deliberate
28:28and will determine which one of you should be eliminated.
28:33So this week, J. Manuel taught you all about applying makeup.
28:37But sometimes you have to look good at a moment's notice.
28:40And sometimes you don't have a mirror.
28:43I knew it.
28:44So that's what today's challenge is.
28:46You will have three minutes.
28:48To apply a full, fierce night face
28:53with absolutely no brushes,
28:55no applicators,
28:56and no mirror.
28:58Are you ready to dive in?
29:00On your mark, get set, go!
29:05Slash it on, girls!
29:10I don't know what I'm doing.
29:11I'm gonna need you to move both.
29:12I'm gonna need you to move.
29:13Five, four, three, two, five!
29:17Stop it!
29:18Hands in the air!
29:19Everybody get back in line!
29:20Alrighty, first we're gonna have Brittany.
29:26Cruella.
29:27Oh my God!
29:29That's horrible!
29:31Right?
29:31Can I imagine that walking into a party?
29:32Looks more like the sort of morning after makeup.
29:34You took the makeup like a Crayola
29:36instead of an actual makeup tool.
29:38Alrighty, Brittany.
29:38Brittany, you had a photo shoot
29:40where we made you a different ethnicity.
29:43Here is your best shot.
29:47Sister!
29:48You look like a black girl, girl!
29:50I was feeling it.
29:52Oh, I loved it.
29:53Brittany, this picture reminds me
29:54of a picture of me and my mama.
29:56It's bringing me back.
29:57Alright, Brittany, thanks.
29:59Naima.
30:00Looks kind of like a Rand McNally roadmap in the face.
30:04Here's your best shot.
30:06She was Icelandic.
30:07You're one of those girls
30:08that who knows where you're from.
30:09So it's quite hard to switch your ethnicity.
30:12Ooh.
30:13Yeah.
30:13You know, you're such a beautiful girl.
30:15This looks like a mall photograph.
30:18Rebecca.
30:19It's a car wreck.
30:21You know what you did?
30:21You did the 1970s cheek
30:23when the blush went all the way
30:24into the hairline, kind of into the hair, too.
30:26Disco.
30:27My mama used to work that.
30:28And here's your best shot.
30:29Rebecca was Italian.
30:30Ooh, that's gorgeous.
30:32Wow-we.
30:33One thing I would have liked
30:34is if you didn't smile as much.
30:36I would have liked to see you say,
30:37ciao, Bella.
30:38Mmm.
30:38I think you hit a home run.
30:40You did a great job.
30:41We're always saying you're so safe,
30:42so this, you know, kind of took you to the edge,
30:44which was really important for you.
30:45Next is Kenya.
30:46You're rocking the shirt.
30:47You're giving us some subliminal.
30:49Just, you know, think about that.
30:51You don't have any night makeup going on at all.
30:55You gotta put some makeup on.
30:56I mean, that's a challenge here.
30:57Here is your best shot.
30:59Oh, gorgeous.
31:00Love.
31:01Korea town, here we come, girl.
31:03This shot is absolutely breathtaking.
31:06I don't even see a black girl.
31:07I see an Asian woman,
31:08and that's what this is about,
31:09about embodying it from the inside out.
31:12You nailed this.
31:14Noelle, here's your best shot.
31:16You look fabulous.
31:17The one thing that I saw is your eye range.
31:19You give us this the whole time.
31:20It's the same eyes.
31:21You gotta change it up.
31:23Just give us variety.
31:24Okay.
31:24Noelle, it's okay for all the other girls
31:26to wear flip-flops except you.
31:29You're the shortest girl.
31:30You have to pretend as if you're just as tall
31:32as those other girls.
31:33I just don't see model in front of me.
31:36I don't see edge.
31:37I agree.
31:37I don't see anything.
31:38No, there's no edge, no.
31:39I don't see it.
31:40Tatiana.
31:42Wow.
31:43She was half black and half white.
31:45Can we see the close-up on Cher?
31:48I think your face is dead.
31:49I don't like the face at all.
31:51Kaelin.
31:52So you had a makeup...
31:54What?
31:54I don't see no makeup.
31:56Wow.
31:57Ooh, that is stunning.
31:59This should show you how much makeup
32:01you can apply to your face
32:03and still look natural.
32:04Christina.
32:06So you had a makeup challenge
32:07to check you out.
32:08It's not edgy.
32:09There's nothing there.
32:10It's very plain Jane.
32:12East Indian.
32:14Wow.
32:14Wow.
32:14I think you look possessed.
32:16She is a deer in headlights.
32:18That's it, right there.
32:19Tiffany.
32:21You had a photo shoot.
32:22Here's your best shot.
32:24She was Native American.
32:25Native American Indian, yeah.
32:26Yikes.
32:27You look like a madam in a brothel.
32:29I don't feel like you're bringing anything
32:30from within.
32:31All right, thanks.
32:33UV.
32:34I would have loved to see you.
32:36You always put on tons of mascara
32:37like Tammy Faye, like I do.
32:39And lots of eyeliner.
32:40It would have been nice to see you
32:41with a bright red lip
32:42because your lips are so nice.
32:44I love it.
32:45I love it.
32:46There's no passion in the face
32:48or any strong, you know, feeling.
32:50My problem is,
32:51is that your look for me
32:53is not translating into pictures
32:55the way I would like to see it.
32:57Michelle.
32:59Somebody's walking up very hesitant.
33:01Right now, you're just so uncomfortable.
33:02You're not coming off strong
33:03and it's coming off very unattractive.
33:05Why don't you tell him what's going on?
33:06What's going on, baby?
33:07Because I know.
33:08I think it's pronounced in, in,
33:09the Tygo, I believe.
33:10It's just like a bacterial thing.
33:12You fool me.
33:13I didn't know that you had this
33:15until your attitude just hunched up
33:18and said,
33:19I am hiding a deep, dark secret.
33:21You must learn how to forget it.
33:23Here is your best shot.
33:25She was an Eskimo.
33:26If you think about Eskimos
33:27and the intensity that that culture has,
33:29it would have been nice
33:30maybe kind of straight on
33:31and just kind of,
33:32I just felt the cold.
33:33I agree.
33:34It's a horrible picture.
33:35And I could have done so much better.
33:36I wish you were crying in the picture
33:41because you look gorgeous right now.
33:42One morning I woke up
33:43and I had a stye in my eye
33:45that made me look like an alien
33:47from another planet.
33:48But I went to work anyway
33:49and I spent the rest of the day
33:51posing like that.
33:54You know,
33:55you just got to project happiness
33:56no matter what.
33:57All right, Michelle.
33:58Thanks.
33:58Thanks, honey.
33:59Christina.
34:03It's the same
34:04Village of the Damned
34:06gorgeous big blue eyes
34:08and I'm bored with it.
34:09I really love this photo.
34:10I love the intensity
34:11finally in her eyes.
34:13Tiffany.
34:14She has some striking features
34:15but it's not enough.
34:16Brittany.
34:17Brittany's larger-than-life personality
34:19will work in her favor.
34:20It worked for Janice.
34:22Didn't it now?
34:23I'm still here.
34:24Rebecca.
34:24I do like Rebecca
34:25and I think that
34:26there is potential in her.
34:27Kenya.
34:28Extraordinary.
34:29She just seems to deliver
34:30week after week after week.
34:32Even when we're criticizing her
34:33she's sucking it in
34:34like a Spongebob Squarepants.
34:36Naima.
34:37I think what Naima's problem is
34:38is that she's actually
34:39stepped back a bit this week.
34:41She was very quiet.
34:42I almost ignored her.
34:44Kaylin.
34:45Each week her photos
34:45are flawless to me.
34:47It's as if I took this
34:47a tear out of
34:48any Vogue magazine.
34:50Noelle.
34:51When I was looking at her
34:52even in her casual
34:53flip-flop way
34:54it doesn't even read model.
34:56I agree with you
34:56that Noelle
34:57looking at her
34:58is not a model.
35:00But then I remember
35:00looking at her photo
35:01and oh my gosh
35:03it was one of the strongest.
35:04Tatiana.
35:05I think she's cute
35:06and she's an interesting model.
35:07She's not cutting it at all.
35:09Michelle.
35:09The skin problems aside
35:11the girl has big problems.
35:12I've had bad feet
35:14and psoriasis
35:14and you know
35:15pimples on my ass
35:16but I hid it.
35:17Yuvi.
35:17I think there's something
35:18in this girl.
35:19This girl looks like
35:20a marshmallow with lipstick.
35:22Not to be rude.
35:23Jen.
35:24You could look better
35:25in a photo
35:25than this girl.
35:29I have 11 beautiful girls
35:31standing in front of me
35:33but I only have
35:3410 photos
35:35in my hands
35:36and these 10 photos
35:37represent
35:37the 10 girls
35:38that will still be
35:39in the running
35:39towards becoming
35:40America's next top model.
35:43The first name
35:44that I'm going to call
35:44Rebecca.
35:48Rebecca the down-home
35:52girl next door
35:52proved
35:53that with a little
35:54Italian contessa
35:55she could be edgy.
35:57Congratulations.
35:58You're still in the running
35:59towards becoming
35:59America's next top model.
36:04Christina.
36:06Tatiana.
36:08Tiffany.
36:09Your face is
36:10undeniably strong
36:11but you can't
36:12just rely on that.
36:13You gotta give me
36:14that extra
36:14thanks.
36:16Kaylin.
36:19Naeem.
36:22Brittany.
36:24Brittany, my sister.
36:25You worked this picture.
36:35Michelle.
36:38Michelle models
36:39get styes.
36:40They get herpes
36:40on their lips.
36:42Gotta stay strong.
36:43You gotta stay focused.
36:45Congratulations.
36:47You're still in the running
36:47towards becoming
36:48America's next top model.
36:51Will Yvie and Noelle
36:52please step forward.
36:58I only have
36:59one photo
36:59in my hands
37:00and this photo
37:01represents the girl
37:02that will still be
37:02in the running
37:03towards becoming
37:04America's next top model.
37:05I will only call
37:07one name.
37:09The girl that I do not call
37:10must immediately
37:11return to her loft,
37:13pack her belongings
37:13and leave.
37:14Two of you represent
37:17the opposite
37:18of one another.
37:20Yvie, the judges
37:21look at you
37:21as having
37:22all the potential
37:23in the world
37:24and then
37:25three out of four times
37:27your pictures have been
37:28wah, wah, wah.
37:30Noelle,
37:31the judges see you
37:32and they say
37:32she doesn't really look
37:33like a model in person
37:35but we look at her pictures
37:36and she photographs
37:37beautifully.
37:39Who should go home?
37:40the girl with all
37:41the potential
37:42in the world
37:42or the girl
37:43that's not very
37:44model-esque
37:44but takes
37:46some good picture.
37:52Yvie, congratulations.
37:53You're still in the running
37:58towards becoming
37:59America's next top model.
38:02Thank you so much, guys.
38:08Peace out, homies.
38:09Thank you so much.
38:16Now, you can either
38:17dwell on it
38:18or you can love it
38:20for what the experience
38:20that it was
38:21or I can piss and moan
38:22about the fact
38:22I didn't win.
38:23I'm not going to
38:25hold anything.
38:26What I think's next
38:27for me is definitely
38:28getting home
38:28to see my baby
38:29because I want to be able
38:31to provide a better life
38:32for my son.
38:33Stay tuned for scenes
38:43from our next episode.
38:45Coming up
38:46on America's Next Top Model
38:48at a windy
38:49and wet photo shoot
38:50Michelle struggles
38:51to remain confident
38:52while battling
38:52her skin problem.
38:53What happened to the energy?
38:54Really got to work
38:55on the energy thing.
38:56While Brittany
38:57struggles to find the bar.
38:59Tranks!
38:59Will her partying
39:00go too far?
39:03All right.
39:05Now
39:17going up
39:21go too far?
39:23Will her partying
39:24& miss
39:25?
39:26How true
39:26them
39:27are
39:28ous
39:29Getting
39:30down
39:30a
39:31
39:31eviden
39:32lips
39:33now
Comments

Recommended