Skip to playerSkip to main content
  • 11 hours ago
Laughter Chef 3 - 25th April 2026

Category

📺
TV
Transcript
00:00:18The audience sitting here is informed that today is the birthday of Samarth Jurel.
00:00:24A new day is dawning by the Laughter Chefs Committee
00:00:34That look, hey, they are going back, friends, this is what is happening, that is why we are taking out this candle march today.
00:00:54Because a few years ago, such an incident happened on Aaji's day.
00:00:59Which was not at all favorable to our civil society.
00:01:07A strange creature was born into the Jurel family today.
00:01:10The doctors congratulated everyone by saying that it was a boy.
00:01:15But when did that boy become a horse?
00:01:19No one should know
00:01:34And today, we will all ignore the birthday officer of that same human horse for two minutes.
00:01:40what's this, friend, look over there
00:01:51Hey, what's this, friend, babes, babes, janu, hey, we are a growing couple, friend, even after being trolled, we are not happy
00:02:03Dagdu Dada Dagdu Dada
00:02:06What are these growing things?
00:02:10what is this
00:02:14Go ahead and bless me, where are you Jadu?
00:02:25Gaya I am your student
00:02:26Get Lost
00:02:28Your kindness
00:02:33Your appreciation
00:02:34Don't talk bug from here
00:02:41you let it be
00:02:42you let it be
00:02:59You guys address Indiame Clean City
00:03:02Akbar Declared
00:03:04Which then came up
00:03:14Plotte doesn't do this every day, but he was born dying with a vow, will he ever be beaten by heaven?
00:03:27Dhinchyak Pooja came on Vicky Bhai's elder
00:03:31Ali's elder brother was the brave Prince Ayya.
00:03:36Ajugar was angry at the fake brother of Shori Bhaiji on the elder brother of Pooji.
00:03:43So why is anyone coming to Samarth's elder brother, R Bharti Samarth's elder brother, especially from Andhra Pradesh?
00:03:53Magician Sham with his son Mohit
00:04:15Samarth's fans say that Samarth has become so famous
00:04:19That anyone can find it with their eyes closed. Today, magician Sham ji has come among us with his
00:04:28Blindfolded, he searches for Samarth.
00:04:31What are you talking about girl fan, let's go and blindfold your head.
00:04:43Sir Watt this putt samdhing suzhi suzhi suzhi suzhi this
00:04:55Truth
00:04:59Oh my god, it really happens in very strange places.
00:05:03The unknown and unbelievable story of the unequal, amazing intelligence, which has been ignored, is about to come true.
00:05:12A dangerous truth
00:05:16Adhishy game is baat to begin
00:05:20What, the boy whom no one sees with open eyes
00:05:24Today I am searching with closed eyes how big a thing it is.
00:05:31This burnt Astarte
00:05:35this command
00:05:54The elder one has been showered with proof.
00:06:08has happened
00:06:08has happened
00:06:09Lush is
00:06:09We are f
00:06:09Kreang
00:06:09Is
00:06:33Lush Auri
00:06:33Wow
00:06:34The Magic of Oz Had Gar
00:06:50how do you do it
00:06:52This is everyone's question
00:06:57Hey Apate, Four Tartali, Lot Achhe
00:07:00Bills Bull Ice Ballists will now be accompanied by the Jesse Samarth Ice Ballists.
00:07:08Breakfast ye bro is ye avavte pro todo set wav
00:07:16Chaliv
00:07:26He Zand Mah Ji Ag Dia
00:07:31Agaleka Alle
00:07:46he woke up
00:08:00that now what is the fillna mad hey
00:08:05Hey what's up hey what's cooking
00:08:21It has increased a little, some times, some, some, some.
00:08:35Hey, nothing will happen, otherwise his part will be ruined.
00:08:49This bike is beautiful then you can take it in your hand
00:09:03I have heard that Teja's birthday is also coming, so I want to wear black clothes for Teja.
00:09:09Direct
00:09:20This is high boiling tea, this is my Sarpwani
00:09:25AP Bad De Ap Bad De
00:09:35So let's go as we all know.
00:09:38that Krishna is very scared of needles
00:09:44No Ala Ala Krishna Hey Krishna come
00:09:54Ala ala is not mine, no, if I faint then I will not go
00:10:04Kidu, do not agree with me, I will not give return gift from Samarth, I will not give ownership of my entire property.
00:10:23No, I'll put it on, I'll put it on,
00:10:30Put it on, put it on, I will not give you my property, I will die, you too will not put it on, friend, please put it on here, friend.
00:10:38My friend, don't attack me, finish the job by stabbing me, these people wanted to have a meeting with me.
00:10:57I am getting attracted to you, my heart is laughing with you
00:11:06� день I am in love, yes my heart is doing pop
00:11:19I got swabbed, yes, my heart
00:11:27these clouds
00:11:31There is a shortage of cylinders in the country
00:11:32I am cooking food by burning myself
00:11:34Is
00:11:35Where is the Sandha Athi Sandha
00:11:37Happy Bade Sandh
00:11:39Thank you
00:11:44Thank you
00:11:45Thank you
00:11:46Thank you Mohic
00:11:48very nice friend
00:11:49ok jhar kha wool
00:11:51Thank you
00:11:53Come on sister, get something nice made for my brother. Today I will make something that will make our Sabard ji happy.
00:12:01The identity is connected, whenever I am going, I say yes, whenever I say yes, don't say yes.
00:12:07He doesn't feel good about himself
00:12:10Hey, I will tell you, we will make a struggle, let's clap for Goda and Chana Bhauji.
00:12:26Today all of you will make a horse on Samarth's big horse.
00:12:37But in a minute I made a horse
00:12:44You do the testing, do the testing, let's see the i-app photo.
00:13:01If he has a son then let's see the ghuda bhuda.
00:13:05Look at this, it will fit in.
00:13:07This is his elder brother, so horse
00:13:09Now when Alvish's birthday comes, they will say, Sir, make it not like this, now they will not say anything.
00:13:19Come on, this is what you guys are seeing.
00:13:22This is Hors Bombolini
00:13:25Bomblini
00:13:29Bomboli is a very famous street breakfast of Ichchhli.
00:13:34Bomba beans are generally round and it is stuffed and when you eat them
00:13:40So there's a volcano-like boost.
00:13:42So I'm just a horse banana bomb you are
00:13:44So let's look at the criteria
00:13:46How to Make a Hors Bombellini
00:13:49Minimum with inch
00:13:50Seven inches of beans take this
00:13:52ok prom head to tail
00:13:54That height should be proportionate
00:13:56Because of you I have to turn mango into a horse.
00:13:59Couldn't you and Latwar have become
00:14:02Soft and fluffy
00:14:04Bomblini is like
00:14:05It is soft and fluffy
00:14:07Chocolate Filling
00:14:08This will be the chocolate filling.
00:14:14As you have seen
00:14:15A full unit will be
00:14:17will not be separated
00:14:19And the presentation, as you all have seen,
00:14:24Take Aye Saban
00:14:29You have to make it round and round like this.
00:14:32and how to put it inside
00:14:33Why don't I worry, I don't have time, I don't have any problem
00:14:38Those Khainan brothers
00:14:40Don't trust anyone, you are the first
00:14:41Make good jaggery
00:14:42my elder brother's car
00:14:45Sir, I eat three times in the morning, that innocent girl
00:14:48This is very nice
00:14:49It eats, it just eats, it doesn't come
00:15:01So he will make it by looking at the mirror.
00:15:05You are today's superstar
00:15:07Hey, what will you make of yourself?
00:15:09The thing is, it's making the world, nobody knows.
00:15:13So spare me, friend
00:15:15Hey, today he is talking about the same thing.
00:15:21So keep it as is
00:15:36Laboratory, still sees the hooves
00:15:37So what are you making?
00:15:38I am making a horse
00:15:40And in the vasti jaggery p раздел bejat khakad
00:15:46My actions in this place are also known as jokes, here there is a joke, how can this thing be found inside it?
00:15:54de tale int iske andar yeh kase dale rakhal chodo jindi me batao yeh kaise karna achiva iske andar
00:16:05How to serve chocolate? After frying it first.
00:16:18Who will make my horse? Liker Bais is a game of making shapes. Shape Do Ban Jaye.
00:16:27Sana is making the shape, don't take it lightly, I know one thing, you did that too for me.
00:16:36Buddy
00:16:41Why did you give this? Why did you give this? To wipe the nose. Sometimes if my nose gets runny, I ask.
00:16:57What trouble has happened to your life? You were still wearing a good look, useless one.
00:17:06What is the matter with Mikamma, Nola is chanting, Khago is also of Aniya, I am still waiting, what is the matter
00:17:18Two of them looked at me and wore it and came in the Panchpat and hey brother, this is what happened in India.
00:17:25Why my brother-in-law?
00:17:27I swear by the Goddess, I have come, I have come
00:17:31I am feeling good today, first I come as a school kid, a nine-tenth year old, today I am a twelfth year old.
00:17:43Come on, I'm all grown up today
00:17:46Friends, today in the happiness of the elder brother, Samarth's fan is also there, at least she is thin, Samarth is fine in her T-shirt.
00:17:53It seems that a little bone is capable of this.
00:17:59Thank you, thank you, Tshat there are more fans
00:18:06Are you a fan of Samarth?
00:18:09may god give you wisdom
00:18:12What was your compulsion that you are a fan of Samarth?
00:18:15What is this red colour, except Charukh Salman
00:18:26Wow, how smart you are
00:18:30There must have been some such compulsion.
00:18:32How much do you guys spend to write She Baati?
00:18:38You fans of Marth
00:18:40Wow Bai, Kalyug
00:18:41Is it Kalyug?
00:18:42This is Kalyug
00:18:43Kluge is
00:18:43Okay, let's take some more of this for us.
00:18:46You Yai Show Show
00:18:48How much does it take to make it a chart waver? Have you heard the song 2 1 2? Have you heard it? You are welcome.
00:18:57Fana, who listens to all such things, oh sister-in-law, you are alone and I am with you like my horse.
00:19:07You will make it so much that I can stand
00:19:10Yourselves go to give support much support much subscribe if Aptu ne one se az if une ko
00:19:16If you ask me to do the work then I will not do it, if it is a matter of choice today, friend.
00:19:23The good thing is not money, but getting into Yale
00:19:41E
00:19:42Ikh go Ikh for
00:19:457 inches
00:19:50This is it.
00:19:51guys
00:19:52what is the procedure?
00:19:53I want to change my partner
00:19:56done done
00:19:56okay
00:19:58No
00:20:04I said I want to change my partner
00:20:07exactly that means you want to leave the show
00:20:09Apsiani is the Lady
00:20:12What is the fight between these, I am Bittu
00:20:15Today the hearty boy will make Kharri today
00:20:19I have no doubt that I am a tadka
00:20:23So my husband should have come for me.
00:20:25And your pursuer is the udder itself.
00:20:26Aaj dega ladai buz ki matro ke saal kurbadey
00:20:29Your black bus is
00:20:30Your black bus is
00:20:34Now Jun Vicky make me a horse
00:20:36He doesn't even have a hand anymore.
00:20:41Anarstisha Yai he also grazed
00:20:43Come and sing like this
00:20:50Lat Now Lat Now
00:20:51Now live the lentils, now heat them
00:20:52And then give him a shave
00:20:55And then give him a shave.
00:20:57Now before making a dick, please fuck her from behind.
00:21:00Now
00:21:05I don't think
00:21:06I will have to roll it, friend, it is difficult to roll it, if I flatten it then it will be uneven, then I will roll it.
00:21:12Yes and you had told me lastinge alepino na mirchi, I saw it in the last episode, understood jala hoshyar
00:21:18Understand yourself
00:21:19The Alepinos have come to give you a few, these are the only real Alepinos, what is this in front of you too?
00:21:31I don't know if this one also looks as poor as Ankida, you must be poor, you drown your life, playpenio
00:21:38No, what will happen?
00:21:39That it is not like this, I have eaten it before!
00:21:41Everyone is put into it
00:21:43Why does it have to be put in?
00:21:45Not yet, see?
00:21:46This poor man knows a lot
00:21:48In this way she is just extracting oil from her own body.
00:21:50This is a stretched heel
00:21:53That God, please instill such a creative energy in me today that if I live, I will become fatter, but the bomb said
00:22:00Yes, basically if you break it, the naan will look thick, yes it is like this, cook it well.
00:22:06You will fall, what are you doing?
00:22:14Everyone is making it very small, let me calculate, let me calculate
00:22:38Shri Bakhetani
00:22:39Did you make this?
00:22:41Can you make Sramurga?
00:22:42Atani
00:22:52He got ahead and made himself walk
00:22:54Rukh Ja Aapi was to meet first.
00:22:56It's done, friend
00:22:57I should work on my increasing progress, have you gone mad?
00:23:00what shape is this
00:23:02his back
00:23:04Where will Garsam go?
00:23:06raised it high
00:23:07what has been done
00:23:08Why is this buffalo lurking?
00:23:11No, after some time the mace will also hit
00:23:16It is also hand made tuna
00:23:18wake up like this
00:23:19or someone standing
00:23:21Bhambo made it soft
00:23:23Bhandu Leet Bambu Leet
00:23:27This is a mule made
00:23:31A why friend
00:23:33I am getting married and I am getting married, I am getting married, I am curious to know this sign.
00:23:47Di bhunt jab torti honi ki aadekar measure chaharam me incur elevator
00:23:58I felt like I made it, I made it, it looks good
00:24:10Why are you spoiling the code of Ankita, your superstar Disha Kaala?
00:24:16I have reached till dinosaurs, slowly civilization is changing, so this goat is also changing.
00:24:20This is a dinosaur
00:24:21I will tell you everything about them, I will make you this beautiful girl
00:24:32now give
00:24:33Tuda abar neeche me dekh ye bahut hai
00:24:48Look down and connect
00:24:51yes yes brother
00:24:56Who would have made mine?
00:24:57this is the elevation
00:24:58This Elivesh is an artist
00:25:00I am making this ruffa.
00:25:13Teja
00:25:16make your legs thick, make your legs thick
00:25:18pregnant
00:25:23gota bigadga
00:25:26Bharti look at this
00:25:27I have never seen such a thing till today
00:25:37Look special, even the British should come for this
00:25:41I will charge you double the tax.
00:25:45double rent
00:25:48This is just Sheikh
00:25:49We are here with Samard Kabarde Mana
00:25:51Please fill the leftout of Bahanja please
00:25:54where double
00:25:55I am the English queen and I have come
00:25:58I am not attracted to Onych
00:25:59vagina
00:26:00yeh palen trobhashyat jhalati atrah chalaton
00:26:04that avgs
00:26:07Anidhin V
00:26:08I will be blessed with the gift of Dichan Ashov
00:26:19Aviv Dichan Adid Dichan Atti
00:26:23Wah Lab Shesho Akrishna Shell Bigas Taran Kashmir Akrishna
00:26:27That was my turn, Kashmir became my
00:26:42I have sold an inch with my tongue, Baba.
00:26:47You have become immature
00:26:56Sudhej ji made him a sir, what a thing, Sudhej ji became a donkey, oh the mace made him a donkey.
00:27:00How are you telling me today, how are you helping me because they worked hard and bit me very well.
00:27:11If it is a little thick then keep it on the side.
00:27:13Make my Isabel very fat, I wonder, I wonder, give her a bag full of clothes and get out of here, I wonder
00:27:33Much, you brought it, I want to tell you how badly these boys are doing.
00:27:40Oh my god so veni gift oh my god it is here too brother oh brother oh brother
00:27:50Hey look, save money and buy IFTS, is this Nikki Pantsil guy?
00:28:02Hey man, this is really a good thing you have done.
00:28:05I am a big fan of Rajabra, I will take all these things and the rest is Krishna.
00:28:11will keep
00:28:12Why, why, will you give me another Raki, let me go here only?
00:28:15When he gave his laptop to him
00:28:22Thinku hai laptop hai mere vad
00:28:23Seeing you, my heart starts to cool down
00:28:26Ache In Mi Dede
00:28:27Ache In Mi Dede
00:28:30When your milk is given
00:28:42Your this
00:28:44Eche Jab Dedde
00:28:45Keep this and keep it here, Ishaada once again for all the fans of Samarth
00:29:05Loud applause, all the fans of Samarth, come forward and let's take a photo.
00:29:10Are they Fehan Adi?
00:29:11Hey! Are you a doctor?
00:29:13Thank you very much, thank you very much, Ija photo
00:29:16Happy Berte Samard
00:29:22Thendu Thendu
00:29:23to Handu
00:29:25were buried where the tribe
00:29:30Why did Vela break down in Tharma?
00:29:33Sayaji's stomach got shortened after reading the book
00:29:55Baby you are one in a million, your waist is shaking
00:29:59Like the oil of your beautiful Sanye, Dubey Bido Hud Lambale
00:30:04Millo
00:30:04Dudesh paji, if you look at a woman of your age then where will everyone
00:30:09Mention the party, the doctor should come back after leaving.
00:30:27They zoom in
00:30:30Hey Arjun
00:30:33After that, bring it a little towards the horse.
00:30:41you make it
00:30:42No, I can only give advice tomorrow.
00:30:45I can give you advice tomorrow
00:30:50The neck is twisted
00:30:51I have become a Hindu by roaming around the world.
00:30:55The effect is a little pearly, it is strange, it is hot, I will tell you right now.
00:31:09I am very happy
00:31:12Its stem is wide and big, hit it with a rolling pin.
00:31:27Your whip is almost treacherous
00:31:36If you look at the reason brother, you will not feel like making it.
00:31:55You people are lagging behind in this matter, ours will see it, it felt as if it would eat right away.
00:32:02will go
00:32:04Allai need is you beed abhi mera khoda dekhna bas vire ek reston kol do please mere gahan deyar an
00:32:13Money please friend
00:32:15Please friend, please show me mine, just look at mine, this is the inertia above in Kedarnath
00:32:24Hey father father father father father brother, there is magic in his hands
00:32:40Bai Saw Karan refused even better than the photo, what should we do after leaving this place?
00:32:47Why don't you make yours better? Ivan is getting bigger but
00:32:52I have taken my pramana, look, yours is made of tarav, it is a big special thing, the well has gone bad, look, it has become a barn.
00:33:11Really cute leg, read it friend, cut it now, it is very much for them, I have cut this leg after keeping it on them.
00:33:23lift from the bottom
00:33:29This is the name of the Gai Vangi, who has now become the honor of the Rakhyaaj.
00:33:47मेरे प्रमरें तोडी तुप्रायश धें.
00:33:56Who made my wife cry?
00:34:01I want to give him a shout out
00:34:04Chef Kudos from me
00:34:07You have made Harpal ji's mood good.
00:34:14gave his ego
00:34:15uh it's right
00:34:24That you adopt yourself is your donation
00:34:30will take his prasad
00:34:32Take your Prasad or write it very correctly.
00:34:35Sudeji Phool Diya Sudeji Ghudi Cashews Kashmiri Crab Banari Ekada
00:34:56Karan, your wife has made this horse, do you have anything to say about it, she has made such a big donkey.
00:35:02He is not visible to you
00:35:06What's the matter Karan Bhai, donkey, that's why you are after the donkey, now our buffalo has become a donkey, fire and nose are flying
00:35:27Is this a horse or a dear?
00:35:36His friends sent him a message saying, "What if I forget this?"
00:36:05Brother, your life is set.
00:36:06The new set has been made, so are you roaming around on the shooting set like a donkey from a horse?
00:36:14By the way, Brother Tir remembers
00:36:16What did we all run around in Jubhu Chupati?
00:36:25There was a time when I used to roam with horses
00:36:27Now look, he is preparing food with shake.
00:36:33Well, brother, you are still the same.
00:36:35Even before, you would see any mare coming and going on the road.
00:36:38You used to flirt with her and you still do the same.
00:36:44I'm going to go, you got hot without doing anything, even today the cost of hard work increases.
00:36:52It's fun to see your circle
00:37:01I was not happy after seeing this, no, how did you make this and listen, I have some things, listen, I have selected this.
00:37:07No
00:37:10Where is this filling from
00:37:21Talker Ankita
00:37:33This is the dung of the goat
00:37:35This is Gode's lead artist, this is the lead artist of the show
00:37:46Both of them are talking about Khuja, Khuja is saying these things, do your own thing.
00:37:50Nine ten nine one hey kya chila hi ja raha raha hai ten nine eight seven shikt wife wife tree to
00:38:03Wife is jealous, she keeps doing this at home.
00:38:09Every now and then cashew nuts keep coming, these are the remains which have been lying inside the ground for years.
00:38:23It was buried, it was brought by digging
00:38:28Should I make him a horse, a mace, a camel, what should I do? He is not saying anything to you, why are you saying anything to him?
00:38:33is saying
00:38:37Let me tell you this first of all, the shape, size, horse is not visible at all.
00:38:44Gotta name it
00:38:46Sir let's call this harpoo
00:38:52If it was a herpo, it would have been equal and swollen, but this is not correct.
00:38:57You fried too much, blocking the brown area.
00:39:03Castlewriter Action Aathu, Aathu, Aathu, Aathu, Aathu
00:39:14Oh, this eight, three pieces of Goda
00:39:18The only thing I feel is that it's not filled.
00:39:27It is very crisp, not fluffy, but definitely golden brown.
00:39:31This shape is good, big idint batch also bamboo leni
00:39:39What is this, this is Samarth, sir, this is the horse that goes wandering on Saini's back
00:39:49Sir, please tell me that it is very tasty, instead of putting the filling inside, they applied a coating on top.
00:39:54Sir, I have done it inside also, friends, you are watching Horse Limbachia
00:39:57Sir, it is not soft and fluffy, and it matches the shape a little bit, but on top
00:40:09If you apply the coating, then that Gordon Brown color is not visible.
00:40:18Finally, I would say that this hors d'oeuvres bombolini has no filling, it is not cooked, it is better than this
00:40:25don't give
00:40:32It is 7 inches, the neck is not made properly, this is the text above.
00:40:37Oh, Wada filling
00:40:44The filling is not right, there is too much flight, so it is not proportionate, the shape is not right,
00:40:51And you didn't even give a presentation, look, this grass is lying right here, it's okay, do that.
00:40:57Chee was
00:41:02The healthiest horse, my brother has to lift Dubai,
00:41:11The size is even. If I talk about frying, it's fine, you have fried it golden, but if I talk about detailing
00:41:18If I do it, there is some flaw in the detailing, this hair is not right, okay, this shape is not right.
00:41:26Yeah, I'll check the stuffing.
00:41:30The pilling is clearly visible
00:41:35I think the filling is good, it is soft
00:41:38But Gode's detailing is
00:41:40She's a little lacking there
00:41:48So Goda is singing
00:41:50This is a dog
00:41:56Okay, the size looks fine.
00:41:59I am not feeling the filling
00:42:01Good
00:42:02Asshole leaked from behind
00:42:09The good one is the goat
00:42:11It is golden brown, soft and fluffy
00:42:13he will say
00:42:14That the overall filling would have been a little more
00:42:17So it seems better to me
00:42:19Good effort, that's a good thing
00:42:24It is more than good
00:42:25It has some seating arrangement
00:42:26Sometimes he gets left behind while running like this.
00:42:31goes well
00:42:32goes well
00:42:34goes well
00:42:36goes well
00:42:41goes well
00:42:44goes goes
00:42:50goes
00:42:51The thighs are exactly the same size and the detailing is also good.
00:42:59You did a great job for the goat.
00:43:01It looks fluffy, look at it, it's writing and I'm getting chocolate ganache in the bite.
00:43:20And it has a nice crunch on the outside, it looks nice and sauf on the inside, the shape is also very nice.
00:43:29Bai, I have not given you a tongue, Bai, take this tongue and do it like this.
00:43:37Good job Karan N Elvesh, you guys did a great job, Jaliya ji, today those who spoke on Samarth's big day
00:43:49Balle Balle Karai
00:43:53Elvesh and Karan
00:44:15You are watching Nivea Soft Daily UV and Realme smartphones to present laughter, soft and intense power.
00:44:25Baichchh Spices and V Perfumes
00:44:27Lotus Germa Botanics, Kissan Chutneys, Vinod Intelligent Cooker, Pour Home Air Freshener and Indiagate Basmati Rise, Special Partner, LG French
00:44:39Door Refrigerator, and All New, Nissan Gravite
00:44:47Hey Bharti, hey yes Sudesh ji, today is Samarth's birthday, if you don't want to cut the cake then it's okay but you should feed it to me.
00:44:53Two
00:44:55Samarth's cake cutting is the cake that was lying there last week.
00:45:00We've kept your cake outside, but the studio people didn't give us permission, sorry.
00:45:07He says that it is okay till the celebrity, now will he cut the cake of the supporter also on the bet?
00:45:13So go out quickly, go out, go out and cut the cake, cut it quickly and feed it to the birds.
00:45:20external
00:45:29Who makes it grow outside in the sun?
00:45:31I made a mistake and this is the punishment I got.
00:45:50Samarth will be surprised, Samarth's surprise is ready.
00:45:59Now, what happened?
00:46:18Samarth will do something brother, come on he can come in any time
00:46:22eprise ne, ne, what is it
00:46:41UPRISE JUDGMENT JUDGMENT JUDGMENT
00:47:00Apiksa Proutix is ​​after me
00:47:16Today it is my friend's house, it seems as if the whole world is in the house, today it is my friend's house.
00:47:36Is
00:47:50Today is my friend's barn, today is my friend's barn
00:47:57There is a hole in the house, there is a hole in the house, there is a hole in the house
00:48:12Now the rain has started
00:48:15Hati Baare Hai, today we are coming to make Samarth's elder brother more fun.
00:48:21Those artist genes have set a different vibe for musical concerts in India.
00:48:34Genes have made India jump by singing a song.
00:48:39Hey Raul Rad Dia
00:48:44Ladies and gentlemen, you are not ready for this, brother.
00:48:58You created trouble for me and pierced my heart
00:49:09You did not feel pity for me
00:49:14Didn't see my helplessness
00:49:16You found it and kept it with me
00:49:21O Dil Pe Chalai Shoriya
00:49:24O Dil Pe Chalai Shoriya
00:49:30You did not feel pity for me
00:49:35But I saw my helplessness
00:49:40What are you saying? Didn't you feel pity?
00:49:45Ghapk baate e, milska u aaye
00:49:48Bade baar din ye aaye
00:49:52Bar Bar Dil Ye Gaaye
00:49:55Live for thousands of years, this is mine
00:50:02api bertesh du u
00:50:05api bertesh du u
00:50:09a meandering guy
00:50:11Nia came down, do you know who is this person walking, who is Nia?
00:50:16Sefar Ye He Left Me
00:50:23You together colored my love and my heart started to dance
00:50:29Will you give me milk bottles, yes? yes you give one
00:50:32What are you showing, will Harka take everything, will it be sold at home, will it be sold in the market?
00:50:40It would be good if we process it here.
00:50:47Who are you daring, do you even know who I am? Come on, let's go.
00:51:02I suggested that you are going to Bot Dubhai Shubhai Hajiga, Anni Dubhai go and come back, ok take him along too.
00:51:07to Elvish
00:51:08Elvish? Take stone skewer
00:51:11Say, you go away, O brother.
00:51:14Play Play
00:51:34When I used to sing in the train, we used to go like this, now I have forgotten that you will go.
00:51:39Let us go
00:51:40I am sitting behind the curtain, I don't want to go behind the curtain
00:51:46fuck me
00:51:48fuck me
00:51:50Pardesi mere aap jani bhaana dere
00:51:56I will not forget to remember you
00:52:02I don't want to go to the curtains
00:52:07So Vicky hasn't partied since day one, will you get some money?
00:52:17Taju ji, we all are big fans of your songs.
00:52:22But there are two such fans of your song.
00:52:25You must have seen many reels on your song on Main Kya Bolu Urk
00:52:28But it is absolutely accessible
00:52:31you you
00:52:33She kept me with her heart
00:52:36He drove his nails into my heart
00:52:39He drove his nails into my heart
00:52:44This reel should not be rekhrate
00:52:47Raju ji should be shown live
00:52:49Don't see my compulsion to crave for myself
00:53:02what is the argument
00:53:04Hamai
00:53:16Doje to dera pyaar mil gaya
00:53:20Both together and this introduction
00:53:24Pratima V Tuchhan Pratima
00:53:26S dilen humai s ad hai
00:53:34She is the first girl who makes me go crazy after seeing her.
00:53:39Friends, you will be the real party
00:53:43I'm not, just come, just come. Hold this, hold this.
00:53:49I have said this to you, my love, my love
00:53:53This heart of mine has broken
00:53:56Like this, like this
00:53:58This pride in my eyes, you left me in your path
00:54:05You together colored me and struck my heart
00:54:13And fired arrows at my heart
00:54:20I want to tell you one thing
00:54:23I know him from Elle
00:54:25Very big cardiologist
00:54:27I respected them so much
00:54:33But let me give you a message if you want to keep your heart good.
00:54:36So why do you show pride by opening your heart like this?
00:54:42Quickly we'll be on to the next cooking battle
00:54:45get it cleaned up
00:54:47I was saying that whatever we are capable of
00:54:49Very Dil Pek Aashiq Hai
00:54:53Agdaph
00:54:54Come and see what we are going to make today.
00:54:57Watt
00:54:58what is this or
00:55:02Wow
00:55:03Looks Like Apple Pie
00:55:05what are you doing now brother
00:55:08This is for our big hearted Samarth
00:55:11Dil Peck Basundi Paratha
00:55:15Basundi Paratha?
00:55:18What kind of paratha is this?
00:55:19Basundi What is Basundi?
00:55:21Why are you making stale things for my growing age?
00:55:51It should be like this Let's go for a market run Nia Didi Arjun Elvish Jannat Kashmira Abhishek Ankita Hai Jak De
00:56:03To collect milk, take this dude dude
00:56:10Our secret sources told that Ali Goni did not steal, he gave it, the poor guy got scared when he was caught, see.
00:56:16You bring half Basundi, what is Basundi Basundi?
00:56:24Roller Roller Here are the Rollers, move on both of them, I am this
00:56:35What should I give you? Even if Gashmeera brings it, what will she uproot?
00:56:39I put this extra, thank you, look, let's use it.
00:56:43Shake it now Hey Gudgud
00:56:47Sister, what is Basundi? Sister, don't tell me, sister, please tell me, friend, I swear I won't tell you, sister.
00:56:56Matala this matalana khayo ji
00:57:03Let's start Geisel identify action
00:57:09Gashlaitar Ye Slaitar Ft Me Doshslaitar Akt Me Vyaive
00:57:17This can lead to a cynical workflow
00:57:18There is a nail in my hand and mine.
00:57:19This dry earth
00:57:20Dry donation af..
00:57:21Eye, why two
00:57:22They are showing it like fire, will everyone take away everything, will they go home and sell it for a living?
00:57:29Ajaya, give me the milk, give me the milk, why did you give it to me in the basket, I took it, I did not steal the milk, it was my right.
00:57:39I brought that country
00:57:45You have brought it, I will bring it back, keep it quiet, Peshmira ji, where should I tell you, come, hey, who is your milk?
00:57:50I took some things brother, but not some things, friend, I know which things were not visible, right?
00:58:01What gift did I get on my birthday?
00:58:07Look, I picked it up from here and took it with me. Why is this? Abhishek is gone but not a single item.
00:58:14I don't know, this one of ours is a week old, my counter has been changed, something has also been picked up from the side.
00:58:19Can't bring chickpeas to make this
00:58:24Sona, your colours are for everyone
00:58:26But I can't put so much, just put it, friend, it is two, one, two.
00:58:32There was a big problem in this. There was a big problem in the village and what was the problem here.
00:58:51They will give all the cardamom and then apply it on my hands.
00:59:09Ale dvrbsha chasi vichasa patanu ahyā osṣamdhi tar patani me kha hai
00:59:15This Sakshi has forgotten that he has started moving ahead. Sheikh, this is not a milk cake, brother, what is a milk cake?
00:59:28is this milk cake
00:59:35I am doing Marg Milk, don't give me instructions, make me into me right now, don't tell me Sthaju
00:59:46This is what she is looking at
00:59:49Don't do it, what have you done? I want a million things here, if I cross it with this,
00:59:59It is good to have it done
01:00:07Is good
01:00:08You move aside, I am giving you a dictation, do you even know who I am?
01:00:12Let's go milk
01:00:14Your people are partners at control
01:00:16This is heating you up and cooling you down as well.
01:00:19Wure time why is he doing this why is he doing that
01:00:35Milkmate won't come out of it, my brother's ni's all stuck to it
01:00:43And the gas is slowing down
01:00:47Milkmate
01:00:49Milkmeat Takla
01:00:50Rabri Rabri
01:00:51Full Takla Full Takla Full Takla
01:01:03Today you have a bode, right?
01:01:05Today I will make such a Basanti for you, I will make such a Basanti, I will make such a gift for my brother, I will make such a gift, such a gift
01:01:14I will make it, I will make it like this, just like that, remove it from here, I will make it sweeter, okay, let's see.
01:01:27These snakes are poisonous, you remember that
01:01:31It is perfect
01:01:31Chakar kam dalati ki milkmate so already he will be sweet
01:01:35I made a mess
01:01:36It will be sweeter
01:01:38Bitti, please don't do this.
01:01:40Jochit Malunus is followed by greatness only
01:01:45Give me a boil, friend
01:01:47put all the mats
01:01:50Nakh le khi r le r le le is liva, gi, shiao, burab
01:02:00what is it
01:02:01Aza are pelan, churna pelmatars nashetit, if
01:02:03Hue Nasheti Ki Aro
01:02:14That you have put it, everyone has to put it, I spit it out, only if you put it all will it get spoiled.
01:02:22Raju Bhai, first of all thank you so much that you came especially to Samarth's elder brother, his mother and daughter also
01:02:29refused to come
01:02:32But you came and created such a wonderful atmosphere that it was fun, we will not let you go empty handed.
01:02:40You are thinking that we will give you new stones, we will give you my favorite Pore Home Air Fresheners Hamper
01:02:54This is our exclusive gift hamper of Pore Home Air Freshener
01:02:59hey you are good
01:03:01Full of Pushmu, girls will go crazy
01:03:12From today onwards, Raju ji, whenever you go to perform, please spray this.
01:03:17It is completely different from typical room fresheners
01:03:22Because its fragrance is very unique and different.
01:03:27And look at the bottle, it is so beautiful, it gives a very premium wipe and look, Kareena ji also said this.
01:03:34Is
01:03:34Sungiye Na Va Por Home Air Freshener Va
01:03:40Perfect Pregnancy Por Perfect Home She is Happy Chudeji
01:03:51You keep singing and keep entertaining, A Bharti Samarth Elvish Abhishek Teja, their love team is so active.
01:04:05Bharti
01:04:05Which love team brother, what what what, we are all working as labourers in the show.
01:04:17Xxx fagacagagagagagagagagagagagag Atsub tell me you do ade mirm tomorrow adhyay du dund and luda kar do lundesh with them
01:04:27Do it slowly, it is good, loot it, Ashar Bha�лас nchra agh, loot it, do it well, good it
01:04:31Kar 90 nu asya PAEE in a possible dadat
01:04:39What about herself, the poor unfortunate woman has come, don't hit me today.
01:04:50You, the gardener, are roaming around and the one who is working is Chotu, go ahead.
01:05:02Work kar bhujha tarya or this thing would have been correct Three
01:05:12As soon as something comes, they make it and take it, instead of making it a dirty thing, they are taking it.
01:05:41has brought
01:05:41He is coughing himself and is also blowing on me and eating me like this.
01:05:57Gave
01:06:05Now Nimbu Tak Ladu, no lemon, no fatail, then Asundi Kashya would be made, Basundi Tashist would be made.
01:06:11No, this was Dudla heating up the cards, Rabhadi is being made, Padla is being made and Paneer is yet to be torn, it has to be torn.
01:06:18It seems that without tearing it, it will not be as deep as the plan.
01:06:26I have explained as much to you people.
01:06:33So you will get all the guide bill jaga vil bhi ling faratha hai kare consistency wallcaric flow this that that that cut
01:06:41Let it burst inside, this is right, Sundhi Ma understand, I felt it inside me,
01:06:49This is a chaisa, this will be fried, what will it be?
01:06:53that what will happen with the clearing of excess khalar, more will become more will become, will wake up in my obedience
01:07:14Just that much
01:07:17Adhiya is being strict, nothing brother, I am strict.
01:07:21She does all the work, she is so good that she keeps doing it as I go to do it.
01:07:25No, no, and then brother does it.
01:07:29Friend, get the work done and support me, friend
01:07:35Whoever is standing at your counter, come and take this.
01:08:01Sadhe ji does it and athana someone will come to us, the subscription was taken from here, the price
01:08:32That the good ones are good ones and they seem to be good ones.
01:08:39That Dank Skewer Nich Me Ter Jachi Poligi Nikhmyons Here Ter Ampe Is Para Dante
01:08:56Kafnt Syara Achhij Atijye Jajamad In Rahata Suchi Achhi Na Gargai
01:08:59If I want to do this then I will stick to your rules.
01:09:08This Ragh〉
01:09:08Having taken this drink, Arjun became so proud that he was shocked.
01:09:20Not today, friend
01:09:21If the problem is solved then it is because of the lack of coordination between the two parties.
01:09:25It's mine now
01:09:26you know
01:09:27Pildhya was the tree
01:09:28Get a subscription now
01:09:37Pildhaya aje liya shud se lid
01:09:45bi:k atz师 l ki bhekhi ya�lers
01:09:49Abhishek
01:09:50What
01:09:52Oh my god
01:09:57Echoche
01:09:58Get out today
01:09:59Good
01:10:00Get out today
01:10:04Bhavji, something friend
01:10:05Hey, what should I give you if you go, wow
01:10:07What have you done to yourself, I don't have to get involved in it.
01:10:09Hamezaad you have shown your wonders
01:10:11You went near Kashmir
01:10:13I will remember Bhabhiji, you are sending it to me.
01:10:15You should always send me
01:10:17I will go
01:10:19When you need me, please come
01:10:20Go away, go away for sure
01:10:23ok you go
01:10:28Sometimes
01:10:29Sometimes
01:10:30ever be
01:10:31not separated
01:10:33there will be
01:10:35Sometimes Kushi
01:10:38ever be
01:10:40Show me what happens, sister.
01:10:42Aryach scene is going on, right?
01:10:46I knew
01:10:48That you will definitely stop me Bhaji
01:10:53If you go then
01:10:54look again
01:10:59If I left
01:11:00So how will your short look?
01:11:02How will your short look?
01:11:04your need only
01:11:06You came lying for short
01:11:08Bharti was not sitting on anyone
01:11:11of the seat
01:11:12Wahai
01:11:17Vahai Samarth
01:11:19Dude that
01:11:20Dude, that girl has come wearing a T-shirt with your name on it.
01:11:22As soon as she says this, she gets Samarth to do that.
01:11:24IsMajik IsMajik Wah Biliz Kahri Hai Villa
01:11:34friend, friend
01:11:37Don't make a Sheikh now
01:11:44friend, friend
01:11:51love you too
01:11:53love you too
01:11:56Answer to this with a leaf
01:12:04The weather has become
01:12:05What a rabri baniye batr
01:12:07High is the consistency so it looks like
01:12:09Me
01:12:12Me
01:12:14It has become Sudeji, it has become
01:12:16Cool it down, what should I blow into it now?
01:12:18Make eight into two seventy-two
01:12:20What is roti, like the said atta gundo na
01:12:22tall
01:12:26Inside it, Banare Ausni
01:12:29Inside him Banare Ausni
01:12:36I definitely want to make it in this, right?
01:12:38I am making it in this I know something Nia brother
01:12:41pt
01:12:43ct
01:12:55Who took my flour, friend?
01:12:58You people took flour from here and gave it to you people.
01:13:12Give
01:13:16What is Olly?
01:13:21Alai Marketing
01:13:35She is very selfish, she is a very selfish girl.
01:13:38Shad you
01:13:53Look, daughter, five inches
01:13:56char una che na
01:13:57Isn't it right then
01:14:02Put it on the gas now, Ali.
01:14:04I feel doubtful
01:14:05I feel doubtful
01:14:06Good morning Tiger
01:14:10Cut Ajan's Dasarmkin
01:14:17its sahiteghe, karan, to do so
01:14:20Be my Thelya
01:14:26Do not be afraid of me
01:14:27Rahe de pautya pautya pautya Rahe has cut it, Vaas is cutting yours too, your pair is fine
01:14:52For the spoiled
01:14:54Whatever you have given me with love, my love, is like a sapphire for you.
01:15:03Is it made of charcoal?
01:15:04Charint, make this much boat, let's see how well he has made it?
01:15:07He took eight and a half, sir, he does it again.
01:15:09How will you do it again now?
01:15:11Did he come out singing?
01:15:29What has a Tule done?
01:15:30I told you four times, you should see Jashvi, you should see him, you should not see him.
01:15:36I will not see you, I will have to hug you
01:15:38have to shit
01:15:42Come again, it is not like you can just give orders.
01:15:57Comfortable girls, don't rub your head, otherwise it might happen.
01:15:59put it on the side put it on the side
01:16:01He doesn't have to leave
01:16:08Jalie, it is ready here
01:16:10Aai Teja made Tya
01:16:2510, 9, 8, 7, 6, 5, 4, 3, 2, 1
01:16:44Good, star winning
01:16:45Formation means that it's not showing a perfect shape
01:16:49Yes, lighter, action
01:16:59If you're a husband, you're in love with someone
01:17:023, 2, 1, go
01:17:05What's the name of the set?
01:17:10What's the name of the man?
01:17:11You're a little girl
01:17:12You're a little girl
01:17:13Because you're a senior
01:17:16Senior
01:17:29Heart design
01:17:30This looks a little bit
01:17:32Oh, okay, man, you're a big guy
01:17:34Oh, same, girls
01:17:39Same overacting
01:17:41What was the last episode?
01:17:45You've got the bell
01:17:47Look at how big the bell is
01:17:50That's not correct
01:17:52The consistency of the bell is not correct
01:17:55Look at this
01:17:56I mean, you're not winning
01:17:56I mean, where do you win?
01:17:58When you make it like this?
01:18:02Come on, come on, come on
01:18:04Come on, birthday boy
01:18:06What's this?
01:18:06You're a good boy
01:18:07You're a good boy
01:18:08You're a good boy
01:18:13You're a good boy
01:18:25So you're good
01:18:34Water
01:18:34Ichcha is visible inside the fruit gin, Basun dika, he has also fed me Kachori today sir.
01:18:40This is heaven, come, I will feed you too, so tell me Jiya, you wear underwear and I will eat whatever you want.
01:18:45Ajannat aao jais lithar akshan athu athu
01:18:52You yourself you yourself you this is not the text of Basundi, look at the Basundi you have made, Rabri and
01:19:07Khoya has become like this, we will play the flute or else two will come out from inside.
01:19:18The layer of the paratha is underwear, I will eat it please no, it is underwear, I will eat it please no sir, stay away
01:19:25So I came, you made it.
01:19:42You can see the shape, let me check this sir, water will come from inside sir, if it comes then water will come.
01:19:48This layer is flat on both sides due to which the underwear does not look flat.
01:20:05Basundi is granular, a little thick, big still, this is written
01:20:10I can see the flow coming out here and the shape is even, it is good, the sweetness is correct.
01:20:17Hey, Juba's done, bale bale bale Basundi, it's okay, a little
01:20:39The consistency is good but the top is clearly not cooked completely, it is raw.
01:20:46Big Boss Boys
01:20:53The sweetness is also good, you alone have given a very good update Ankita ji, very good.
01:21:00You have taken a very good point, daughter-in-law, daughter-in-law, daughter-in-law, you have worked hard, gas upright, good ones
01:21:15Come on, dhooj dhooj dhooj dhooj dhooj bhooj dhooj dhooj bhooj now I did not scream there was a tractor above you
01:21:37Okay, I'd look good. Now there's one thing in this which is a very top layer, isn't it?
01:21:43I'm liking it
01:21:44But this shortness of heart has increased the problem.
01:21:48Yas Liker Auction
01:21:58Abhi Shake Stepney Mixment Sub Milk Will Also Come
01:22:01Now after listening to Shake's English, we will give you the book of United Nations Load.
01:22:06My name is Victoria Chakraborty
01:22:10I should edit your work, you like to become a god, not a load.
01:22:15From today you will stand with a chavki dhari
01:22:24Not here, it had to be made here, not here
01:22:39You have shaped your paratha this way but the top one is different and the bottom one is different.
01:22:45What you are thinking is Paratha is actually Mathki Sir, please taste it, it is very good.
01:22:52Wow, the sweetness of Basundi is visible, it is overcooked on the pan, it is not hot, right?
01:23:01That's what it looks like from inside
01:23:05So formation means a complete perfect shape is not visible.
01:23:09Yes lighter action today which made Juba's life better is this
01:23:26Elvesh and Kara
01:23:29You should get your porridge done or keep it for a while
01:23:37Nivea Soft Daily UV & Real Mesh Smartphone with Preservative & Chef Alignment, Powered by Chch Masala
01:23:45Envy Perfumes, Lotus Dermabotanics, Kisan Chutneys, Vinod Intelligent Cookwear, Poor Home Air Fresheners,
01:23:55and India Gate Basmati Rise, Special Partners, LG French Door Refrigerator, and All-New Nissan Gray White.
01:24:05You both get a Gift Amper from Envy Perfume, Envy The Power of French Perfume.
01:24:30I thought you were just unreadable?
01:24:45You are also stupid.
01:24:50Today some people have been made show guides, whose name will come, you have to show that state to Abhi Sheikh.
01:24:57Let us come to you Haryana Kumaon.
01:24:58Well, what all food is available in Haryana?
01:25:00Like here we eat butter, maha, nuni ghee.
01:25:05Nia, will you come to Haryana?
01:25:06Nia, if it comes to us, the whole village will also come with us.
01:25:10Everyone will bring their Luni Ghee in a pot, for Liya, oh our Luni Ghee, if you laugh, then
01:25:19You are in love with someone, 3, 2, 1, go, look at me, did she get ready on the set?
01:25:28Is that me? You all hurt me because you are a senior Krishna.
01:25:43How many things do you remember, it's been 14 years?
01:25:54I have found parking at your feet, two cars need parking today, Sunita Aunty
01:26:02I'm so sorry
01:26:06The ones who made Juba suffer are Elvish and Kara.
01:26:11Today, on the occasion of Samarth's death, those who made Juba's words go viral, Elvish and Kara
01:26:22May you be in trouble today, may the Elvish and others be in trouble
Comments

Recommended