Skip to playerSkip to main content
  • 7 hours ago
What.Lies.Beneath.S01E52.540p.x265.AAC [Full Movie] [Watch Free Online]Full EP - Full
Transcript
00:01Did you give that to the police?
00:03Do you believe that you're in front of your business?
00:05What do you want to do with your life?
00:09The story of Ivana has no new development.
00:12Why did you think that Mrs. Taliesel had to do with Bianca?
00:16My son, that's a lot of people.
00:26Ma, are you okay?
00:27Are you okay?
00:28Papa is here.
00:30I'm just going to ask you.
00:31Let's go.
00:52Ryan!
00:53Ryan!
00:55Mal!
00:58Mal!
01:01Mal!
01:06Mal!
01:08No!
01:09No!
01:17No!
01:20No!
01:22No!
01:24No!
01:29No!
01:32Oh, my God.
01:59Oh, my God.
02:29Bess, alam mo ba yun?
02:37Dizelle?
02:39Alam mo na ba yung nangyari?
02:41Bakit ano nangyari?
02:42May tumawag kay Ma'am Liwanag dun sa principal's office ngayon lang.
02:46Nasa hospital si Bess.
02:47Nabugbog daw sa sementeryo.
02:52Okay na.
02:54Huwag na kayong mag-alala.
02:55Maliit lang naman yung sugat.
02:56Minsan, ganyan talaga pag-ulo.
02:58Madami kung magdugo.
03:00May konting pamamaga.
03:01Wala namang fracture o intracranial bleeding.
03:04Base yan sa initial scans.
03:06Regarding naman sa abdominal area,
03:09may tenderness o pasa.
03:11Pero, wala namang internal damage.
03:14So far, stable naman yung mga vital signs mo.
03:18Pero, para makasigurado tayo,
03:21we will observe you for the next 8 to 12 hours.
03:24Okay?
03:24Salamat, Doc.
03:25Okay.
03:26Please excuse us.
03:27Thank you, Doc.
03:29Magandang araw, Mr. Mora.
03:31Ms. Mora.
03:32Kukuha na lang po namin ng statement si Mrs. Mora.
03:35Sige po.
03:36Mrs. Mora, namukha niyo po ba ang gumawa nito sa inyo?
03:42Anong, sapatos lang nakita ko eh.
03:44Itim na rubber, sis.
03:47May napansin po ba kayong brand?
03:48O, ibang marka dun sa sapatos?
03:53Wala eh.
03:55Plain lang nakita ko.
03:58Wala din, sir eh.
04:00Eh, pagdating ko kay Beth,
04:01nakalista siya.
04:03Sa tingin niyo,
04:03sino pwedeng gumawa nito?
04:05At, sino may galit sa inyo?
04:09Naku, kung yun o yung pagbabasihan.
04:11Mahaba ka ba yung listahan?
04:14Ah, pakitutoko na lang, sir.
04:16Tsaka pakisabi na rin kay Locsin.
04:18Ayaw ko talagang malampasin to.
04:22Mr. Mora, Mrs. Mora,
04:23marami salamat po.
04:24Mauna na po kami.
04:25Salamat.
04:26Salamat po.
04:28Oh my god.
04:30Beth?
04:32Beth!
04:33Oh my god!
04:34Beth, how are you?
04:35What happened?
04:37I was with Alice nung tumawag si Ryan.
04:39I'm so glad you're awake.
04:41Kamusta ka?
04:42Wala.
04:59Oh, Pax.
05:02Nasaan ka?
05:04Nasa bahay.
05:06Wala ka kasi nung gani.
05:09Saan ka nagpunta?
05:10Tamakbo ako eh.
05:15Ikaw ba?
05:21Susundin mo ba ka mamaya?
05:24Siyempre naman.
05:25Siyempre naman.
05:25But naman hindi.
05:29Sige.
05:42Alice.
05:44I want you to talk to me about your dream like you're watching a movie.
05:55Describe mo sa akin ano ang nakikita mo.
06:02No need to interpret it yet.
06:09Nandun nandun nalit ako.
06:14Sa masikip na lugar.
06:21I don't know.
06:23I don't know where I am.
06:28Masyado madilim.
06:31Wala ko makita.
06:35It's fine.
06:38You're doing well, Alice.
06:41My hands are tied.
06:43I'm crying.
06:47Anong nararamdaman mo, Alice?
06:51How does your body feel in that space?
06:57I'm scared.
07:01Terrified.
07:04Okay, Alice.
07:06Relax.
07:09Let your feelings stay with you.
07:14Know that I am here.
07:17Now.
07:19With me.
07:22Safe.
07:29What comes next?
07:35There's...
07:36There's...
07:37There's something.
07:39There's someone.
07:42May...
07:42May tao sa labas.
07:46It's okay, Alice.
07:49Take your time.
07:52Anong nasa labas?
07:54I can hear your footsteps.
08:02It feels so small.
08:05Mama!
08:07Mama!
08:10Mama!
08:13Mama!
08:15Mama!
08:15Mama!
08:16Mama!
08:16Mama!
08:19I can't...
08:21I can't...
08:26I can't...
08:27I can't...
08:29but...
08:37I can't!
08:41I can't...
08:42It's okay, Alice.
08:44But I was the kid.
08:46The kid was crying.
08:50Does that mean that I was really that?
08:53That was my kid.
08:58I don't know what the truth is.
09:04Something really happened to me when I was a kid.
09:09That's why I can't remember when I was five years old.
09:13I've already been reading all of my memories.
09:18I don't know.
09:22And why did I get to Scott's mind?
09:26Why?
09:29Was I wrong this whole time?
09:32Oh my gosh!
09:35Alice.
09:36Breathe with me.
09:39Inhale.
09:41Exhale.
09:45Exhale.
09:49Exhale.
09:55You're not one.
09:59We haven't covered important matters today.
10:04May dalawang timelines sa memory mo.
10:08And that's okay.
10:10Memories don't come back in order.
10:13Hindi mo kailangan i-figure out lahat ngayon.
10:16Ang importante.
10:18You were brave enough to face it.
10:22We'll work through it.
10:24One step at a time.
10:28Okay.
10:39Chloe.
10:40Chloe.
10:40Mauna ka na muna.
10:41I just have to take this call.
10:43Okay po, tita.
10:49Jo?
10:50Ma'am.
10:51Wala ko talaga akong makita ang video sa files ni Sir Anton.
11:01Ito ba ang usapan natin?
11:03Wala tayong sasabihin.
11:05Oo.
11:06Eh kasi inakusahan na ko na sinisiraan ko si Angelo.
11:10Eh bigla na lang lumabas sa bibig ko.
11:13Saka alam mo sa totoo lang, kinakabahan ako para kay Lizelle.
11:17Kasi paano kung tama hinala natin?
11:20Di ba ka siya na yung susunod na biktima?
11:22Eh, paano kung si Angelo talaga nanakit sa'yo?
11:25Paano kung sinabi ni Lizelle yung sinabi mo sa kanya kaya kanya sinugod?
11:29Paano kung, paano kung di ako dumating agad?
11:32Pahal.
11:33Pahal.
11:34Okay lang ako.
11:35Tingnan mo, okay lang ako.
11:37Eh, di naman ibig sabihin na tapos na eh.
11:39Pwede naman maulit to.
11:41Kung ayaw mo dumirelet siya sa pulis, sabihin na lang natin to kay Erika.
11:45Ano?
11:46Eh siya naman nagturo sa'yo dun sa sulat, di ba?
11:49Eh, di sabi mo yung inaalam mo na posibleng si Angelo yung sigretong boyfriend ni Luisa
11:53na siya na rin yung pumatay sa kanya.
11:55Ewan ko, bahala na siya dun sa investigasyon.
11:57Hindi.
11:58Hindi.
12:01Anong hindi?
12:03Hindi pwede, hindi tayo sigurado.
12:06Pero sigurado tayong magiging patas at maingat si Erika.
12:11Kapag nasimulan niyan wala nang atrasan, paano kung mali tayo?
12:15Masisira yung buhay ni Lizelle at Angelo.
12:18Handa ka ba dun?
12:19Paano, paano kung kayo ni Chloe masaktan?
12:24Hindi ako manda dun.
12:31Hey!
12:33Pinilang kita ng soup.
12:37Pwede naman daw sabi ng doctor mo.
12:39Ah, Ryan, may coffee din dito if you want.
12:43Ah.
12:46Balik mo na akong taliyat.
12:47Baka nandun yung mekanik ko eh.
12:50Nakatag doon na rin si Chloe.
12:52Pero tay,
12:54babantahin ko po si Nanay dito.
12:56Hindi na anak, pumasok ka na.
12:58Andito yung tita Mel mo, siya na magbabantay sa akin.
13:08Ayun.
13:09Ayun.
13:14Ayun.
13:24Ayun.
13:26Ayun.
13:28You were kinda hard on him last time.
13:31At saka, pinagbawalan natin siya na makita si Alice.
13:50Ayun.
13:53Ayun.
13:55I'm going to give up your name.
13:58Do you like it?
14:02Daddy,
14:04when they saw her name,
14:05she was going to die,
14:09was she afraid?
14:13It's the name of my name.
14:16Yes,
14:18but it's a little description
14:19that she's afraid.
14:21That's why she's afraid.
14:22Because she's not afraid
14:24of her name and her friends.
14:27She's very sad.
14:30When I first realized
14:33how they saw her body
14:36and all of them,
14:40it was like,
14:41it was like,
14:41it was like,
14:43it was like,
14:44it was like,
14:45what the sigma?
14:48But I didn't really understand it.
14:52My aunt said,
14:54I thought it was just a joke.
15:00But for her friends,
15:03it's true.
15:04that's true.
15:11It's true,
15:14my aunt.
15:15I saw my aunt.
15:20He's asleep.
15:21He's full of blood.
15:23I realized
15:25that's not just a tale.
15:30That's the real answer,
15:32though.
15:38That's the real regret.
15:50He will not chill!
16:01He was going to come out with a stretch.
16:04He was going to keep him safe at the other side.
16:06He's going to make this chapter!
16:06Better to come in, his backtrack.
16:09Get up!
16:09Get up!
16:10Get up!
16:17Pet, you're going to be in the hospital.
16:18Pet, you were going to kill him?
16:20What's up?
16:21I'm going to kill him!
16:22Why are you going to kill him?
16:24Why are you going to kill me?
16:25Are you going to kill him?
16:27Then your husband did it to me?
16:30That's what I did to him!
16:31Hey, let's go!
16:37God, let them take away!
16:48Come on!
16:56It's just a pity Ryan and Chloe immediately came back.
17:03Do you have any idea who could have done this?
17:12Alice, do you know where Scott is?
17:15Why do you ask?
17:20Well, we think it could be him, Alice.
17:24Beth wasn't very nice to him the last time, remember?
17:29Scott?
17:31I'm... why would he...
17:34Well, if your speculations are right about him,
17:38then most probably he's capable of doing this too, right?
17:53What's up?
17:56What's up with your spouse?
17:59What's up with your wife?
18:03What's up with your wife?
18:04No, sir.
18:10I don't trust her husband and friends.
18:14Especially my husband.
18:18You're a cigarette?
18:20Yes.
18:21She's not going to put it there.
18:24Is it Alice and Beth?
18:27Yes, they're only, sir.
18:29The condo that Mel put in Manila.
18:33I'm going to call my friend and my friend.
18:38If I go back there,
18:41I'm going to call Mel.
18:43I'm going to call her.
18:45Okay, sir.
19:01I'm gone.
19:02He said everything.
19:02He said everything.
19:19He said...
19:23...work통ing.
19:28I ago, away from her tooth.
19:33Hey, what's going on with you and Mel?
19:35Have you moved out?
19:37Have you moved out?
19:38She's staying with a friend, right?
19:42No, no, it's nothing serious.
19:46OMG.
19:48There's something happening.
19:49Come on, tell me.
19:50I'm sure you need to know.
20:02We're going away.
20:07I want to start a family, but you know her career first, spotlight above all, but of course
20:21I don't want to pressure her to do something she doesn't want to do.
20:24I reminded her, we have a deal.
20:28Once she's settled with her career, we'll have kids now.
20:33But when I asked her if she's ever really going to stop wanting more, she's angry with me
20:40and she accuses me of being unsupportive.
20:48I shouldn't have asked her that.
20:53I warned you before, right?
20:56He's not the right match for you.
20:59There are other things that are better for you.
21:12You do not choose who you fall for.
21:17And I'm in love with her.
21:25Even if it's such a dream of mine to become my dad.
21:27You do not know what to do.
21:45You are a fan of me.
21:47You are an idiot.
21:49You are a fan of me.
21:52You're a fan of me.
21:53I'm a fan of you here.
21:57You are a fan of me.
21:57You are part of me.
21:58What are you doing here?
22:02I told you that you don't need to go here.
22:04And you're still under observation.
22:06She insisted.
22:07Why did you do this with Ryan?
22:09If you're angry with me, you're going to leave me.
22:12I'm not going to die.
22:13She's going to die.
22:14She's going to the hospital.
22:15What do you think about my husband?
22:18She's going to die with Beth in the cemetery.
22:20She's not going to die.
22:22I'm going to die right now.
22:24Do you have evidence?
22:29Beth!
22:30Yes, the angel was in the cemetery.
22:32But why did you tell her that you didn't have evidence?
22:36Why are we not friends?
22:38Hey Lizelle, do you know why?
22:40Even if you are, you have a lot of questions to your husband.
22:50Hold on, hold on.
22:53Just calm down.
22:55I'm not going to die.
22:56I'm not going to die.
22:57What do you need to ask, Nino?
23:10Anton!
23:11I'm ready.
23:13Just hang in there, okay?
23:16Yeah.
23:18Trying.
23:20Thanks for saying that.
23:22By the way, free ka ba?
23:23Do you want to have some coffee with Kat?
23:25Actually, we're also with Tin.
23:26But she just came back from the States.
23:29Tin?
23:31Yung sa Azor residences?
23:35She's been in the U.S.?
23:36Yeah.
23:36One month alone.
23:37Kaka-uwi niya lang kagabi.
23:39But jet lag rung.
23:41See you.
23:58I'm going to die.
23:59I'm going to die.
23:59You're going to die.
24:06I'm going to die.
24:10I'm going to die.
24:12I'm going to die.
24:12I'm going to die.
24:15I'm going to die.
24:16Well, shouldn't they be checking
24:17lahat ng sapatos ni Angelo?
24:20Diba yun dapat ang ginagawa ng mga polis?
24:22Kaya nga eh.
24:23Hindi nila gagawin mo.
24:25You had your suspicions kay Angelo.
24:28Tapos sinayaan mo kong isipin that it was Scott?
24:34Sa ospital.
24:35Sabi mo it could be Scott.
24:37Alice.
24:39That was me.
24:40I said that.
24:41Kahit na.
24:42Kahit na.
24:44Hindi niya sinabi na may iba siyang pinagsususpechahan.
24:47Hinayaan niya lang naisipin ko na it could be Scott.
24:49Right?
24:52Alice, ikaw naman yung nagkwento sa amin,
24:54ng mga ginagawa sa niya ni Scott.
24:56Hindi mo kami pwedeng sisihin nang napagtagtagtagtagtagtagtagtagtfun
24:59namin yun.
25:00Though I already told you, I don't even know what's real anymore.
25:04Hindi ko alam kung nababaliw na ba ako.
25:07You know...
25:08It's possible nanasira ko yung merоминаh ko for something that's not even real.
25:13Tapos...
25:13No?
25:15Do you even understand?
25:20Wow.
25:51Wow.
26:20Bakakang makatulong pa kinalisan pag nalaman to ni Erika.
26:22Alam nila Kiyo na dahil sa etsura ni na Francine,
26:25ayang kaya nilang maglabas-masok sa mundo ng mayihaman.
26:27Di na mapapansin na naglalako sila.
26:29Si Erika Melendez ang may hawak ng kaso.
26:32Ginawa ko ito lahat para sa kapatid.
26:34Di ba may ipagtulungan sa taong tumulung at sumira ng buhay niya?
Comments

Recommended