Skip to playerSkip to main content
  • 8 hours ago
Positively.Yourss.S01E03 [Full Movie] [High Quality]Full EP - Full
Transcript
00:00:14Beautiful days when you're near
00:00:20Simple things just feel so clear
00:00:33Simple things just feel like you're in the middle of the day
00:00:42You're in the middle of the day
00:00:43그러니까 일주일에 적어도 세 번은 만납시다
00:00:46네?
00:00:47사랑, 그거 제대로 한번 해보자고
00:00:51원래 이렇게 질척거리는 스타일이에요?
00:00:54뭐라고요?
00:00:55전 그쪽이랑 결혼이든 연애든 전혀 할 생각이 없거든요
00:01:02그러니까 지금 내 말을 잘못 알아들은 모양인데
00:01:06내가 당신을 도와주겠다고 말하면
00:01:08그러니까 당신 도움 같은 거 필요 없다고요
00:01:12하나도?
00:01:13하나도
00:01:14그럼 그날 일은?
00:01:17그냥 서로 즐긴 셈 치죠?
00:01:21쿨하게
00:01:35조용히 좀 해, 사람들이 쳐다본다
00:01:40진짜
00:01:41어, 이건 하나도 필요가 없잖아
00:01:44쿨하게
00:01:45그래
00:01:46내가 할 테니까 좀 쉬어, 어?
00:01:53
00:01:54다 포기하고 이대로 독일에 가겠다는 건가, 지금?
00:01:59야, 진짜
00:02:06딴 남자 있는 것도 눈 감아줬더니 사람을 별로 보고
00:02:11그래, 시간도 없는데 차라리 잘 됐다, 잘 됐어
00:02:13각자 갈 길 가자고
00:02:18뭐야, 어디 갔어?
00:02:21어, 보비사
00:02:22어, 보비?
00:02:24미안해
00:02:25어떻게 할 거야, 그렇지
00:02:31너 그렇게 말했다고, 애 아빠가?
00:02:34말했잖아
00:02:35나랑은 완전 다른 색의 사람
00:02:37당장 회사에서도 봐
00:02:38그 사람은 사장이고
00:02:39난 일계 직원이야
00:02:40그런 사람이 갑자기 자기애라고 덤비는데
00:02:43이게 맞아?
00:02:44아우, 이 철벽 진짜
00:02:45야, 남자가 마음에도 없는 여자한테
00:02:47결혼하자
00:02:48사랑도 해보자
00:02:49하겠냐고
00:02:50그게 나 좋아서 한 말이겠냐?
00:02:52어머
00:02:52그럼?
00:02:53책임감
00:02:54딱 봐도 책임감 때문이라고
00:02:56어차피 결혼은 생각도 안 했는데
00:02:58여지 남겨봤자
00:02:59기대밖에 더해?
00:03:03소시
00:03:03어, 잠깐만
00:03:06내가 이따 다시 전화할게
00:03:07
00:03:09어쩐 일이세요?
00:03:11지나가다가
00:03:12밥은 먹었어요?
00:03:28요청하셨던 장혜원 씨 이력서와 자료들입니다
00:03:32계획에 없던 아이거든요
00:03:34가장 중요한 시기에
00:03:36평생 올까 말까한
00:03:37기회 앞에
00:03:38찾아온 생명이라
00:03:39네가 노리는 게 돈이야?
00:03:41아님
00:03:42남자 하나 잡아서 신분 상승 해보겠다
00:03:45이건가?
00:03:46오늘은 제가 살게요
00:03:48드시고 싶은 거 있으면
00:03:49다 고르세요
00:03:50내가 오자고 했는데
00:03:52내가 살게요
00:03:53아니에요
00:03:53지난번에 고기도 사주셨는데
00:03:55사실
00:03:56저 오늘 월급 들어왔거든요
00:04:11선택은
00:04:12했어요?
00:04:17전 아직
00:04:18제 인생이 더 중요한가 봐요
00:04:23살아보니까
00:04:25누군가에겐 축복일 수 있는 아이가
00:04:27누군가에겐 짐이 되기도 하더라고
00:04:29아이는 원할 때
00:04:30다시 가지면 되는 거니까
00:04:32다시요?
00:04:36애 아빠는 뭐래요?
00:04:38반대하진 않고?
00:04:41그 사람은 아직 몰라요
00:04:43저 혼자 내린 결정이라
00:04:46오래 끌어봤자
00:04:48여자 몸만 상해요
00:04:49남자들이 뭐 해줄 게 있나
00:04:51대신 나아줄 것도 아니고
00:04:57다시 깼다
00:05:16혼자 오셨는데
00:05:18좀 추여진 거 같아서요
00:05:19죄송해요
00:05:23일어나
00:05:24데려다줄게
00:05:26혼자 갈 수 있어
00:05:28어?
00:05:30고집 좀 그만 부려
00:05:32오죽했으면 날 불러?
00:05:37혼자서도 잘만 해왔어
00:05:40이거 왜 이래
00:05:46안녕히 계세요
00:05:48
00:05:54저 계산 중
00:05:56저 계산 중
00:06:02수고하셨습니다
00:06:16수고하셨습니다
00:06:18여기가 우리의 마음이 기댈 건데
00:06:20엄만이 이게 문제야
00:06:21아무한테도 곁을 안 주니까
00:06:23주변 사람들만 피 말리는 거라고
00:06:25그래서
00:06:30그래서 네 아빠가 바람피는 거다 이거야?
00:06:33말이 또 왜 그렇게 튀어?
00:06:34You're a bit like that!
00:06:36You're a bit like me!
00:06:38You're all a job, so I'll just go!
00:06:41I was going to be a woman, I was going to be a man.
00:06:44I'm going to be a man, I'm going to be a man.
00:06:48I'm going to be a woman.
00:06:50If I'm a man, I'm going to be a woman, I'm going to be a woman!
00:06:54You're all right?!
00:07:02You're my fault, you're right.
00:07:04세상 사람들 다 등 돌려둬!
00:07:07넌 내 편이었어야지!
00:07:15I can't believe it.
00:07:43I can't believe it.
00:07:59Hyon아, 마셔.
00:08:05하... 진짜 이기적이야.
00:08:07무심해도 그렇게 무심할 수가 없어.
00:08:09아까도 봐.
00:08:10딸이 임신한 건 아무 상관없는 사람이라니까?
00:08:16근데 내가 더 짜증나는 건 나도 엄마처럼 될까 봐.
00:08:21엄마 말처럼 나도 후회하게 될까 봐.
00:08:26너...
00:08:26야, 이 답답아.
00:08:28뭘 그런 걸 고민하고 있어.
00:08:30아니, 같은 결정했다고 다 똑같던 법 있어?
00:08:32넌 엄마랑 다른 사람이잖아.
00:08:35애기 낳더라도 충분히 잘 살 수 있는데 왜?
00:08:37그냥 너 하고 싶은 대로 해.
00:08:39누가 지운다고 돌 던지면 그 돌 내가 맞아주고
00:08:42낳을 거면 까짓 거 이 언니가 같이 키워줄게.
00:08:47그러니까 네가 진짜 가보고 싶은 길을 걸어.
00:08:49오케이?
00:08:50오케이?
00:08:51응.
00:08:54응.
00:08:57고마워.
00:09:10고마워.
00:09:12이제 어떻게 할 생각이야?
00:09:14설마 나 할 거 아니지?
00:09:15근데 그 사람이랑 결혼이라도 하려고?
00:09:17아니야, 그런 거.
00:09:32아니 형은 집에 안 가?
00:09:33여기서 살 거야?
00:09:34이래 봬도 내가 네 비서야, 어?
00:09:37내가 모시는 상사 얼굴이 이리 죽상인데
00:09:39집에 어떻게 갈 수 있겠어?
00:09:41뭔데?
00:09:42뭐가 문젠데?
00:09:43말해봐.
00:09:46형.
00:09:47형은 엄마랑 싸운 적 있나?
00:09:49야!
00:09:50아니 대한민국에서 엄마를 안 싸워본 사람이 없어서
00:09:52나와보라 그래.
00:09:53그런 사람이 있으면 내가 하루 종일 박수 쳐준다.
00:09:55나 엄마한테 많이 혼났지.
00:09:57대들다가 혼나고.
00:09:58회초리도 맞고.
00:09:59추운 겨울에 내복만 입고 쫓겨나고.
00:10:01아니 그런 거 말고 서로 상처 주면서 싸운 적 있냐고.
00:10:05너 설마 사모님이랑 싸웠니?
00:10:07아니 그런 게 아니고.
00:10:08아무튼 궁금해서 그래.
00:10:11상처 주면서 싸운 적 있지.
00:10:15그럼 어땠는데?
00:10:17아팠지.
00:10:18나도 엄마도.
00:10:20서로 날카로운 말로 후벼파는데 아프지.
00:10:24당연히.
00:10:25근데 그 상처 치료할 수 있는 거 알지?
00:10:27상처 난 부위를 깨끗하게 소독하고.
00:10:31밴드를 붙이고 며칠만 기다리면.
00:10:33다시 세살이 돋더라고.
00:10:36그래서.
00:10:37상처 난 다음이 중요한 거야.
00:10:40만약에 며칠 만에 세살이 안 돋우면.
00:10:43아이 그럼 충분히 기다려야지.
00:10:45아물 때까지.
00:10:47아니 너 어머니랑 싸웠으면 빨리 화해하고.
00:10:50지금 나이가 몇 갠데 어머니랑 아직도 싸우고 그러냐?
00:10:52아니 내가 그런 게 아니라니.
00:10:56아무튼.
00:10:57고마워.
00:10:59구호.
00:11:00나 못 들었어.
00:11:01구호 뭐라고?
00:11:04아 거기서 빨리 집에 가라고.
00:11:06시끄러워 죽겠어.
00:11:08나갈 때 불 다 끄고 가.
00:11:11아 나 진짜 상처받았네.
00:11:13아 나 상처받았다!
00:11:15아이 정말.
00:11:26야 여긴 어떻게.
00:11:28목마른 사람이 오물파지.
00:11:31고백했다 까이면 이제 친구도 아니다.
00:11:34아이.
00:11:36내가.
00:11:37연락을 안 하려고 안 한 게 아니라.
00:11:39아이 됐어.
00:11:40뽀뽀한 사이가 친구는 무슨 친구야.
00:11:43나는 너랑.
00:11:45언제든지 선 넘을 수 있는 사이 계속할래.
00:11:49나 그런 거 불편해.
00:11:50너 여자친구 있어?
00:11:51아니면 좋아하는 사람은?
00:11:53생기면 말해.
00:11:55더 분발하게.
00:11:56야 황미라.
00:11:57아 답답해.
00:11:59마음 학교 뭐 하냐?
00:12:00너 고민 길어져 봤자 좋은 사람 다 놓친다.
00:12:07나 놓칠 거야?
00:12:12사장 나오라고 그래?
00:12:16우유 수요하는 애한테 술을 먹여?
00:12:18미친 거 아니야?
00:12:19지금 뭐 하시는 겁니까?
00:12:21여기 사장 나오라고 그래요.
00:12:22사장 부르라고.
00:12:24아 이거 나 안 돼.
00:12:26여기서 이러시면 안 됩니다.
00:12:27나오세요.
00:12:28내가 가만 안 있어.
00:12:30고소할 거야.
00:12:30아침부터 사장 나오라고.
00:12:32난리도 아니었나 봅니다.
00:12:33한동안 맥주 물량 들려서 산후조리엄마다 공짜로 돌렸다는데.
00:12:36뭔가 냄새가 나지 않습니까?
00:12:39이거 보십시오.
00:12:40예나 지금이나 지 멋대로 하면서 놀란만 몰고 다니는 강준상구가.
00:12:44대한주류 사장이라뇨.
00:12:46말됩니까?
00:12:46회장님 지시지 않나?
00:12:48일단 누구 봐야지.
00:12:51멋대로 물량을 늘렸다느니 공짜로 줬다느니 이런 건 중요하지 않아요.
00:12:55중요한 건 여자에게 술을 줬다 프레임만 씌우면 되는 거죠.
00:13:00조리원에 숨겨둔 여자.
00:13:02강두준의 호내자.
00:13:04떡밥이 많죠?
00:13:05어차피 판단은 기사를 보는 독자들이 하는 거 아니겠습니까?
00:13:16그러지 않아도 적절한 타이밍을 보고 있었네.
00:13:20적절한 타이밍 같은 건 없어요.
00:13:23타이밍은 만드는 거지.
00:13:24숙부님 잘하시는 거 있잖아요.
00:13:2715년 전처럼.
00:13:29그러다 형님한테 걸리기라도 하는 날엔.
00:13:35도와드릴게요.
00:13:37태안그룹 오너 자리 갈아치울 때가 된 것 같은데.
00:13:43이렇게 서두르는 이유가 뭔가.
00:13:46가만히 있으면 어른이 세연이한테 자라가 돌아갈 텐데.
00:13:50글쎄요.
00:13:52거기에서 만족하기엔 제 인생이 너무 아까워서랄까.
00:14:07그래.
00:14:08헌신까지는 바라지도 않았어.
00:14:10칭찬 한 번, 미소 한 번 바랐던 게 다라고.
00:14:13어떻게 끝까지 본인만 생각하냐.
00:14:15내가 엄마라면.
00:14:16난 절대 엄마처럼 안 살아.
00:14:18알아?
00:14:24재단 일이며 또 손해부는 일들 좀 저버렸더니.
00:14:29산후소련은 또 뭐야.
00:14:30어?
00:14:31미혼모 심탄도 뭐고.
00:14:33기부하고 봉사하는 일까지 관리받을 만큼 제가 힘이 없어 보인단 말로 들리네요.
00:14:38기부는 문제가 안 되지만 그 단체가 어딘지에 따라가지고 얼마든지 물어뜯길 떡밥이 될 테니까.
00:14:43아, 무형이 요새 기자들이랑 라운드 좀 다니고 있더라.
00:14:48걱정 마세요.
00:14:49그때처럼 그냥 당하고 있진 않을 거니까.
00:14:52그래.
00:14:54니 형들하고 요새 별일 없지?
00:14:57뭐 때문에 그러시는데요?
00:15:00아, 니 형 그렇게 되고.
00:15:02그 일로 아직 매체했나 싶어가지고.
00:15:06아, 이런 얘기도 했고.
00:15:08니 엄마가 또 뭔가 일을 벌이는 모양인데.
00:15:12엄마가요?
00:15:12엄마가요?
00:15:22아버님.
00:15:25청담 쪽 그레이스가 보내준 자료입니다.
00:15:27요청하신 대로 업계 쪽에서 평판 좋은 자제분들로 특별히 엄선했다고 합니다.
00:15:32어머, 그래?
00:15:32I'm so sorry.
00:15:39My daughter's daughter, my daughter's daughter.
00:15:45I'm so sorry.
00:15:47I'm so sorry.
00:15:49I'm so sorry.
00:15:50What's the artist?
00:15:51I'm so sorry.
00:15:53Where do I go?
00:15:54I'm so sorry.
00:15:58I'm so sorry.
00:15:59I'm not going to live anymore, but I'm not going to live anymore.
00:16:04I'm not going to live anymore.
00:16:16I'm not going to live anymore.
00:16:17What do you have to do?
00:16:19What is it?
00:16:22Do you want to live?
00:16:23Do you have them?
00:16:27C passé.
00:16:32It's not going to live anymore.
00:16:35I'm not going to live anymore.
00:16:36I don't want to live anymore.
00:16:39It's not going to work anymore.
00:16:42First of all, it's hard to get out of it, but
00:16:45if you're strong enough,
00:16:48you're going to get a lot of weight from it,
00:16:49you're going to get out of it.
00:16:51Then you're going to get out of it.
00:16:55I'm going to get out of it.
00:16:56I'm going to get out of it already.
00:17:05It's a long time for you to get out of it,
00:17:08so I can get out of it.
00:17:11Yes, that's right.
00:17:12And the marketing strategy is trending,
00:17:14and the new channel.
00:17:17Yes.
00:17:18I'll send you back to the channel again.
00:17:23It's a big deal.
00:17:29It's a good taste,
00:17:34but it's a good taste.
00:17:35100% Aromahobo made in premium ale macku.
00:17:40Waila macku.
00:17:46100% Aromahobo made premium ale macku.
00:17:48I can't do that.
00:17:50Do you want to do that?
00:17:52Yes, then.
00:17:54I'll do that.
00:17:54I'll do that before.
00:17:55I'll do that before.
00:17:56I'll do that before.
00:17:57I'll do that before.
00:17:59I'll do that before.
00:18:04Why, it's not because.
00:18:05No, it's not that way.
00:18:07But it's too much more as I think.
00:18:09I'll do that before.
00:18:11Isn't that a change.
00:18:11This is not actually a change, but it's not for sure.
00:18:13I don't have to do that before.
00:18:14Who knows?
00:18:15Who said this?
00:18:16If this is for the new product,
00:18:17it's a lady.
00:18:19What's that?
00:18:22By the new product,
00:18:23it was the January transfer.
00:18:25When I was going to get a new product,
00:18:28it was,
00:18:28what's that?
00:18:30Isn't that a date?
00:18:31What's that?
00:18:39God is like blossoming, which is a simple concept.
00:18:42It's just nothing.
00:18:43It doesn't matter anywhere.
00:18:43I won't do that.
00:18:43It's not just that this was a concept and recipe.
00:18:44It's been a long time already.
00:18:45It's been a full time for me every year.
00:18:46I have been photoshopped here and I'm going to drop a tongue.
00:18:47Why?
00:18:49Why?
00:18:50It's not like you've done it.
00:18:54No, you want to go to Japan and Japan?
00:19:02You've got to talk about your book trying to get in the middle of the series.
00:19:05You've got a letter on the TV show?
00:19:07Can you try holding your book?
00:19:11They've got to work on the TV show.
00:19:12You've got to have read books like TV.
00:19:12You've got to do it.
00:19:13I mean, if you're going to have a topic like that?
00:19:16I didn't.
00:19:17You can't get the bell.
00:19:18I can't tell you the truth about it.
00:19:19You can't speak.
00:19:20I.
00:19:21You've got to think of it.
00:19:22One is one, because you do it.
00:19:26No.
00:19:28No, no.
00:19:34No.
00:19:48Oh.
00:19:49Oh!
00:19:51Oh!
00:19:52Oh!
00:19:52Oh!
00:19:53Oh!
00:19:54What's going on?
00:19:55Are you going to go?
00:19:58No, no.
00:20:00But if you're here, what's going on?
00:20:03I'm going to meet you with the manager.
00:20:05Then, come on.
00:20:06Let's go.
00:20:12Here.
00:20:15Are you going to help me?
00:20:18No.
00:20:20I didn't have any help.
00:20:24I didn't have any help.
00:20:26I didn't have any help.
00:20:28I'm going to take care of it.
00:20:34What are you doing?
00:20:35What are you doing?
00:20:35I'm going to take care of it.
00:20:38We're not going to be a problem.
00:20:39We're not going to be a problem.
00:20:42I'm going to take care of it.
00:20:45He...
00:20:46Please, please have a picture of your wife.
00:20:50It's the case of a tuber.
00:20:52You can't get into it, or you can't handle it right now.
00:20:54That's not...
00:20:55I can't be done yet.
00:20:56See what you're doing in the next one.
00:20:58That's not right.
00:21:01I don't want to take it.
00:21:33I'm the guy who is looking for you.
00:21:33What the hell?
00:21:34You've got to go.
00:21:35I'm the guy who knows.
00:21:36Well, it's the guy who knows.
00:21:38It's just a joke.
00:21:40You're the guy who's the guy who has seen it.
00:21:41I don't think we can go.
00:21:44I'm gonna go.
00:21:45I'm going to go.
00:21:48Just leave me.
00:21:49I'm going to sleep for you, isn't it?
00:21:50I'm going to go.
00:21:51Okay, it's not a big deal.
00:21:55It's just a situation.
00:21:56Oh, my God!
00:21:59Sorry.
00:22:00I'm wrong.
00:22:02I didn't get any help.
00:22:04I didn't get any help.
00:22:09I'm sorry.
00:22:10I'm a bit late for a while.
00:22:11I'm not a bad guy.
00:22:14It's already done.
00:22:16It's our team from a project.
00:22:19But it's okay to make it a little better.
00:22:22I'll go again.
00:22:23Yes?
00:22:23I'll go again.
00:22:26I'll go back to the hotel.
00:22:29I'm sorry, I'm sorry.
00:22:47What's that?
00:22:48What's that?
00:22:51I'm sorry.
00:22:53I'm sorry.
00:22:55I'm sorry.
00:23:04What's that?
00:23:06What do you think?
00:23:10What do you think?
00:23:30Wow.
00:23:30What's that?
00:23:32What's that?
00:23:33How do you think?
00:23:34I'm not eating.
00:23:35I'm not eating.
00:23:38You're not eating.
00:23:40I'm not eating.
00:23:42You're not eating.
00:23:42I'm not eating.
00:23:43I'm not eating.
00:23:44I'm eating.
00:23:45I'm eating.
00:23:45I'm not eating.
00:23:46What?
00:23:47I'm not going to say anything about him.
00:23:49Why?
00:23:49Why is he taking care of me?
00:23:51I'm not afraid of him!
00:23:52I'm just trying to solve it.
00:23:54I'm just going to try to solve it.
00:23:56You're not afraid of me to think?
00:23:57Right, I think he's not a good one.
00:24:00I'm not a good person!
00:24:02Why do you need a cauce and a ketchup?
00:24:06I'm just going to go and get out of it.
00:24:09Yes, I'm just going to get up.
00:24:10Please go to your sandwich.
00:24:13Can you see any other ones?
00:24:15Yes, yes.
00:24:16I'm a little bit worried about this.
00:24:17And you can take care of it.
00:24:20Just don't wear it.
00:24:22Don't worry about it.
00:24:23I'll put it on the phone.
00:24:24I'll put it on the phone.
00:24:31Yes, I'll do it.
00:24:32But you've got to take care of it?
00:24:35Why are you taking care of it?
00:24:36I'm not even going to do it.
00:24:37It's not just like you're taking care of it.
00:24:40So I'm just going to do it.
00:24:41At the beginning of my research,
00:24:44he had enough of it to be all there.
00:24:45That's right.
00:24:46I love you, but,
00:24:48if you don't think I'll try it.
00:24:51Let's go to today.
00:24:55You're so familiar with me!
00:24:58I'm sorry?
00:24:58You're a very familiarest nose.
00:25:03You're a friend of mine.
00:25:07You're a mind of a girl.
00:25:09Even if you're a friend, just you need a friend of yours.
00:25:13I think it's okay with your mother, but you have to find your friend.
00:25:18I think you're a friend, huh?
00:25:21I don't know if it's like a friend.
00:25:21Do you have to meet your mom and your mother and your mother?
00:25:22Why?
00:25:25Well, and I knew that it was fun.
00:25:30He was a kind of young man.
00:25:31I'm sorry.
00:25:32I'll take you back now.
00:25:32I'll take you back.
00:25:33I'll take you back.
00:25:37What do you want to eat?
00:25:42I'm going to go back to the bathroom.
00:25:44I'm going to prepare the bathroom.
00:25:47I'm going to prepare the bathroom.
00:25:47I'm going to prepare the bathroom.
00:26:02I'll take you back to the bathroom.
00:26:22Oh
00:26:30Coffee can drink.
00:26:32Oh, yes.
00:26:33Please, coffee.
00:26:34Sorry?
00:26:37We can just go.
00:26:57I'm sorry, I'm sorry, I'm sorry, I'm sorry, I'm sorry.
00:27:24I'm sorry.
00:27:38Hey.
00:27:44What are you talking about?
00:27:47What are you talking about?
00:27:49What are you talking about?
00:27:51Nona, Hioon 씨가 전에 깠다고 복수하는 건 아니지?
00:27:55본인이 직접 수습하게 떨잖아.
00:27:57내 도움 하나도 필요 없다는데 뭐.
00:27:59그게 진심이겠니?
00:28:01Hioon 씨 그동안 주말에도 출근했다더라.
00:28:03그렇게 얻은 평생의 기회가 눈앞에 왔는데
00:28:06이 와중에 임신까지 한 거 아니야.
00:28:08거기다 억울한 누명까지.
00:28:10지금 기분이 어떻겠니?
00:28:28No, I don't know.
00:28:29What are you looking for?
00:28:32The manufacturer said, coffee is not bad, isn't it?
00:28:37There's no taste of it.
00:28:41There's no taste of it.
00:28:43I don't know.
00:28:43Yes.
00:28:43That's so funny.
00:28:44I'm not sure.
00:28:45Ah, yeah.
00:28:56I'm sorry.
00:28:57You can get a new one?
00:29:01Yes.
00:29:06It's warm, so you can put it in two minutes.
00:29:08Yes.
00:29:14Oh, you're welcome.
00:29:20Hello, do you want lemon tea?
00:29:22Do you want to drink water?
00:29:23Yes.
00:29:49Oh.
00:29:51Oh.
00:29:52Oh.
00:30:16Oh, you're welcome.
00:30:20Oh.
00:30:23Oh.
00:30:26Oh.
00:30:27Oh.
00:30:29Oh.
00:30:29Beautiful days, when you're near.
00:30:35Simple things, just be sincere.
00:30:40I can't wait to get it.
00:30:44I'll stay this way with you, my beautiful day.
00:30:55Hmm.
00:30:58Hmm.
00:31:03Hmm.
00:31:04Mm-hmm.
00:31:07Hmm.
00:31:10Hello, I'm gonna go to the right place to put it on my face.
00:31:12I think you were a good idea.
00:31:16So that's because I didn't have a nice idea.
00:31:20I'm good to get it on my face.
00:31:22I'm gonna go to the right place.
00:31:24I'm gonna have to eat it.
00:31:25I'll eat it.
00:31:26I'll eat it.
00:31:28I'm not eating it.
00:31:29I feel like I'm eating it.
00:31:30What's the reason?
00:31:33The recipe is that for the reason?
00:31:35I can't even see him.
00:31:38I'm too old.
00:31:38It's so stupid to say that he's too old.
00:31:38Why is he so excited?
00:31:40I'm so excited.
00:31:43I'm so excited.
00:31:44I'm so excited.
00:31:44I'm scared of him.
00:31:45I should've had a bunch of other people.
00:31:46I can't speak with him.
00:31:49I don't want to go to the same person.
00:31:51I know.
00:31:52I'm tired of being a friend.
00:31:54I'm tired of being a friend.
00:31:55That sounds so special.
00:31:55I don't know what's going on.
00:31:57I don't know.
00:31:57I don't know what you've done.
00:31:58I don't know if you've been a friend.
00:31:58I don't know if you've been a friend or a friend.
00:32:02I don't want to be a friend.
00:32:04That's what our team is doing.
00:32:05Hey, follow our team.
00:32:11We're the same.
00:32:12That's right.
00:32:20That's right.
00:32:21Have a good time, right?
00:32:30Then I'm going to go to work a lot more and a lot more and a lot of work.
00:32:37You're going to eat a little bit.
00:32:43Lotte is you?
00:32:44You're going to be with me.
00:32:46You're going to be with me.
00:32:47We're going to go to the future.
00:32:49Yeah.
00:32:50We're going to lead you to the future.
00:32:54You're going to eat a lot.
00:32:56I'm sorry.
00:32:57You're going to eat a lot.
00:32:59Oh, really?
00:33:02Oh, then I'm going to eat it.
00:33:09And then...
00:33:11How do you do it?
00:33:12How do you do it?
00:33:13I'm going to focus on the market.
00:33:15I'm going to focus on the market.
00:33:16But if you're looking at the market,
00:33:19I'm going to create a market.
00:33:21You're going to leave the market.
00:33:22You're going to be the same way.
00:33:25Why?
00:33:27What's the reason?
00:33:28You're going to be the best.
00:33:32You're going to take a look.
00:33:34So, first of all,
00:33:35first of all,
00:33:3610 years ago,
00:33:37I've got to buy a oil bottle.
00:33:39I've got to buy a oil bottle.
00:33:41I've got to buy a oil bottle.
00:33:45I've got to buy a oil bottle.
00:33:55I don't know if you don't know what the concept is.
00:33:59That's what...
00:34:00The concept is that it's a concept.
00:34:02It's a concept that's a good idea.
00:34:06It's not a good idea.
00:34:07That's what...
00:34:09I mean, it's all about the reason.
00:34:12You know what's the concept?
00:34:15You know what's the concept?
00:34:17You know, the concept is that a problem.
00:34:20You know, you're not a problem.
00:34:23I don't think so, but...
00:34:26But I can't do that.
00:34:28I can't do that, like, how do you do that?
00:34:29I can't do that, and I can't do that, but I can't do that.
00:34:33That's the case.
00:34:34I can't do that.
00:34:36No, I can't do that anymore.
00:34:38What?
00:34:54Why?
00:34:55Why are you why I'm not helping you?
00:34:58No, don't you?
00:34:59You're gonna.
00:35:01No, you don't.
00:35:01No, don't you.
00:35:03I'm not.
00:35:03I'm just talking to you and you're lying.
00:35:06.
00:35:07I'm going to go home with you.
00:35:10.
00:35:10.
00:35:10.
00:35:11.
00:35:12.
00:35:12.
00:35:13.
00:35:13.
00:35:13.
00:35:13.
00:35:13.
00:35:16.
00:35:16.
00:35:17.
00:35:17.
00:35:17.
00:35:19.
00:35:20.
00:35:27I will.
00:35:29I will.
00:35:31I will.
00:35:31I will.
00:35:33I've been thinking one person, but then I'm going to find one person.
00:35:41I'm not sure.
00:35:47There's one person.
00:35:50Wait, I'm sorry.
00:35:51See you guys.
00:35:54I can't tell you guys how to show you.
00:35:57I'm a little bit offensive.
00:35:58We're going to talk about a little bit about it, so we'll talk about a little bit about a little
00:36:02bit about it.
00:36:03We're going to talk about our team.
00:36:14Hello.
00:36:15Welcome.
00:36:17What do you want?
00:36:19What are you doing?
00:36:21I don't know.
00:36:22I don't know.
00:36:22I don't know.
00:36:23I don't know.
00:36:24Soolar.
00:36:25What is your care?
00:36:26No, because they're all msoni, they want to be cool.
00:36:30They want to display a little bit.
00:36:31No, I'm just going to enjoy your care.
00:36:34You're going to hang off the mail provider conямocally.
00:36:37I'm up with my AT.
00:36:39Here's what I found.
00:36:41There's a feeling for people and if they don't want to play when they got caught, this is right.
00:36:44Okay.
00:36:46That's what I wanted to do.
00:36:47People are so afraid to tell you.
00:36:49Oh, they want to die.
00:37:23What's that?
00:37:24You're going to leave now?
00:37:27Are you going to leave?
00:37:28Or are you going to leave?
00:37:30I think it's not really funny.
00:37:34We're going to have a home to a country,
00:37:35so it's our situation.
00:37:39You're going to be able to do it?
00:37:40You're going to be here?
00:37:44You're going to be on the team.
00:37:46It's not that you can't do it.
00:37:48It's not that it's a real thing.
00:37:50It's not that it's not that it's not that it's...
00:37:52No, I'm just like, as I'm still in my mind, I'm just like a question of my mind, and I'm
00:37:56just like, I don't want to be in my mind.
00:37:58I think the choice is that you can see on your own responsibility, but all the way there are reasons
00:38:03that I can't do this.
00:38:04It's not really easy to decide.
00:38:10So, you...
00:38:11Are you sad?
00:38:15I...
00:38:15I'm...
00:38:16My...
00:38:16My...
00:38:17My...
00:38:17My...
00:38:18My...
00:38:20Oh...
00:38:21Ah...
00:38:24That's right.
00:38:25That's right, isn't it?
00:38:27You don't have to worry about it.
00:38:29I'm afraid I'll have to worry about it.
00:38:31Wait a minute.
00:38:33The director of the lawyer?
00:38:34Yes.
00:38:36This document just write down.
00:38:37Tell him that you're going to be a little bit more.
00:38:46That's what you're going to do with your child.
00:38:47The patient's stress is a lot of pressure.
00:38:49She's also a lower risk of the care of her, and she's also a lot of pressure.
00:38:54She's a lot of pressure on her.
00:38:55She needs to be a good person.
00:38:58She needs to be a huge project.
00:39:03I'm not going to be a problem.
00:39:04I'm not going to be a problem.
00:39:15I'm not going to be a problem.
00:39:25Hello.
00:39:29How did you get it?
00:39:31Did you get it?
00:39:32Hello.
00:39:34It's a phone-in?
00:39:36Who is it?
00:39:37Who is it?
00:39:37Who is it?
00:39:38Who is it?
00:39:39Who is it?
00:39:39I know it.
00:39:42I'm a guy who is a man.
00:39:44Yes.
00:39:46You can take a seat if you can take a seat.
00:39:50You can't sit here.
00:39:528시 밖에 안 됐는데요?
00:39:538이나 되는 이 밤에 남친 있는 친구한테 전화하는 건 실례 아닌가?
00:39:57걔가 아무리 피곤해도 8시부터 자는 애가 아니거든요.
00:40:00우리 애 자는 시간을 왜 그쪽이 가속합니까?
00:40:04아니, 제 말은
00:40:05아까 저녁 7시 이후에 장예원 씨한테 개인적인 일로 전화하는 일은 상가도 벗겨 주세요.
00:40:10용건이 있다면 전화번호 문자로 하시고요.
00:40:12더할 만 없으시면 이만큼...
00:40:13거기서 뭐하세요?
00:40:17깼어요?
00:40:18몸은 좀 어때요?
00:40:20A, a...
00:40:21A, a...
00:40:23A...
00:40:25It's...
00:40:32Now it's like a jelly ring that's just as long as you can.
00:40:37This is a manhung,
00:40:39and this is a hair.
00:40:41Look at this?
00:40:43Yes.
00:40:44Can you hear a little bit?
00:40:45Can you hear me?
00:40:50It's healthy, but I'm going to have a pbc so I'm going to give you a few days.
00:40:57I'm going to give you a little bit better.
00:41:16Somehow it was so warm all around
00:41:19Wonder where your little dreams were found
00:41:25Really want to know
00:41:30In your life, love is rising deep inside me
00:41:38I feel the warmth of your small hand
00:41:43I'll be new, will stop me stand through the night, no fear can't find our way
00:41:55분명 어디서 드러본 목소리인데
00:42:00차민아 웬일이야 여기까지 다 찾아오고
00:42:03나 물어볼 거 있었어
00:42:05뭔데?
00:42:06희원이 애아빠라는 사람 산부인과에서 봤을 때 어땠어?
00:42:09혹시 뭐 하는 사람인지 알아?
00:42:10여기가 떡볶이 하나 주세요
00:42:12계란말이도 하나 주세요
00:42:14계란말이도 하나 주세요
00:42:14알았어 맛있게 해줄게
00:42:15
00:42:16어?
00:42:17아, 잠깐만
00:42:19아우, 오빠
00:42:20
00:42:22그 사람이 우리 회사 사장이라는 거
00:42:24절대
00:42:25절대
00:42:26민욱이한테 얘기하면 안 돼
00:42:27알지?
00:42:28알지
00:42:29근데
00:42:30나중에 알면 더 서운하지 않으려나?
00:42:32너 기억 안 나?
00:42:34우리 대학생 때
00:42:35동아리 가방에서 민지랑 재현이 사귀는 거
00:42:37우리 셋한테 먼저 들켜서
00:42:39제발 비밀로 해달라고 했는데
00:42:41차민욱이 표정관리 못하고 뚝딱거리느라
00:42:43일주일 만에 학교 전체에 소문난 거
00:42:45일주일 아니고
00:42:463
00:42:47맞다, 맞다
00:42:48그 전설적인 사건이 있었지
00:42:50얘는 표정이 투명해서 얼굴에 다 드러나니까
00:42:52오케이, 접수
00:42:54비밀로 할게
00:42:55약속한 거다
00:42:56딱 있어
00:42:57대박, 대박
00:42:59그래, 뭔데 뭔데?
00:43:00재현이
00:43:01민지랑 결혼한대
00:43:03너네 알고 있었어?
00:43:05둘이 다시 만나는 거?
00:43:06
00:43:06재결합한 지 석 달 만에 결혼하는 것도?
00:43:15왜 난 몰랐지?
00:43:16근데 왜 나한테 말 안 했어?
00:43:18나이 무거운데
00:43:19
00:43:20알지
00:43:24어?
00:43:25아니, 희원이한테 전화했는데
00:43:26됐든 그 자식이 봤더니
00:43:28자기 할 말만 하고 끊어버리잖아
00:43:29그날도 그랬어?
00:43:30무례하고
00:43:31겨우없고?
00:43:33글쎄
00:43:33나도 그 스치듯이 본 거라 기억이 잘
00:43:36아, 진짜 어디서 만나도 그런 놈을 진짜
00:43:38근데
00:43:40너 지금 그거 물어보러 온 거야?
00:43:42
00:43:43뭐 희원이 좋아해?
00:43:45내가?
00:43:46아니, 그렇잖아
00:43:47너답지 않게 갑자기 찾아와서 따지듯이 묻는 것도 그렇고
00:43:50그 남자가 괜찮은 남자인지 신경 쓰는 것도 그렇고
00:43:52야, 너는
00:43:55내가 걔랑 세월이 얼만데
00:43:57알잖아
00:43:58걔가
00:43:59일 말고
00:44:00뭐 하나 제대로 하는 게 있냐?
00:44:03뭐 그렇긴 한데
00:44:04왜?
00:44:07그거 물어보러 여기까지
00:44:13저, 혼자 가도 되는데
00:44:22잠깐만요
00:44:23네?
00:44:26뭐야?
00:44:41죄송한데
00:44:42혹시 그거
00:44:43네?
00:44:44아니
00:44:45임신부인 것 같아서요
00:44:48
00:44:49이거
00:44:50무알콜
00:44:51
00:44:52안 그래도
00:44:54이것 때문에
00:44:55여기서 어른들한테 자주 혼나요
00:44:57그냥 음료수다
00:44:58무알콜이다
00:44:59아무리 설명을 해도
00:45:00어른들은 아는 대로
00:45:01본대로만 믿으시거든요
00:45:03
00:45:04그쵸
00:45:04오해하실만 하죠
00:45:06
00:45:07병원에선 웬만하면 안 마시려고 하는데
00:45:10요즘 이거라도 없으면 진짜
00:45:12딱이 없거든요
00:45:13남편은 마누라가 병원에 있든 말든 허구한 날 진탕 취해오는데
00:45:18나도 진짜 확 취하고 싶은 날이 하루 이틀이 아니에요
00:45:23
00:45:24이건 요 옆에 조리원 먼저 들어간 언니가 몰래 넣어준 거예요
00:45:28그 태양주류였나
00:45:30거기 사장님이
00:45:31요새 조리원마다
00:45:33이 무알콜 맥주를 열 박스씩 넣어준대요
00:45:35사장님이요?
00:45:36
00:45:36열 달간 아이 품느라 많은 걸 참고 견딘 엄마들
00:45:41선물이라고
00:45:43
00:45:53박 기자님
00:45:55사내체육대회니 축구동호회니 심지어 모 정치인 동창회 자리까지 몰래 납품하는 건 쉬쉬하면서
00:46:05You can't leave me alone.
00:46:06Well, you're a...
00:46:08I'm not a kid.
00:46:12I'm a kid.
00:46:13I'm a kid.
00:46:14I'm a kid.
00:46:14I'll come back.
00:46:15You're a kid.
00:46:17Then one thing?
00:46:18I'll go to bed for you?
00:46:20I'll be hungry.
00:46:21I'm hungry.
00:46:22I'm hungry.
00:46:22I'm hungry.
00:46:24I'm hungry.
00:46:26I'm hungry.
00:46:31I'm a person who's a friend.
00:46:32I love you.
00:46:33I love you.
00:46:34I love you.
00:46:35I love you.
00:46:36I love you.
00:46:38I love you.
00:46:41I love you.
00:47:01Today, thank you very much.
00:47:04I told you that you didn't have to talk to me.
00:47:07It's important to me now.
00:47:08I think it's important to me.
00:47:10Yes?
00:47:11I think it's the most important thing.
00:47:13I'm not sure.
00:47:14I'm not sure.
00:47:15I'm not sure.
00:47:15I'm not sure.
00:47:16I'm not sure.
00:47:17I'm not sure.
00:47:21I'm not sure.
00:47:22We're not sure.
00:47:22But then you can also see a few more ideas.
00:47:24I'm so interested.
00:47:27You can see the first name you have.
00:47:28And this is the first name you got to do?
00:47:32The first name of the German capital is the option of Korean.
00:47:34Why do you remember me?
00:47:34It's not the right time.
00:47:35You go to France in your country.
00:47:40You're the favorite place.
00:47:40What are you in there?
00:47:40I can't wait till you have to eat.
00:47:40It's your favorite place in your country.
00:47:44It's your favorite place.
00:47:45That's what I'm going to do with you.
00:47:48But...
00:47:48What do you want to do with me?
00:47:50Let's go.
00:47:52That's what I want to do with you.
00:47:54I'll do it with you.
00:47:55...
00:47:56...
00:47:56...
00:47:56...
00:47:57...
00:47:57...
00:47:59...
00:47:59...
00:47:59...
00:47:59...
00:47:59...
00:47:59...
00:48:00...
00:48:03I think I can't believe it.
00:48:04I'm sorry.
00:48:05I think I can't believe it.
00:48:06I think I was too late for my life.
00:48:32Mom!
00:48:37Ah, why not?
00:48:40Mom is always like that.
00:48:41Then I'm going to get out of here.
00:48:43Then I'm going to get out of here.
00:48:45MG.
00:48:47MG.
00:48:51Man, that's the problem.
00:48:52I'm going to get out of here.
00:48:55I'm going to get out of here.
00:48:58Mom, that's the problem.
00:49:00You're going to get out of here.
00:49:01Now you're going to get out of here.
00:49:03It's just that you got to help her.
00:49:05Then I'm going to get out of here.
00:49:07Yippee's mom, you're already Officers.
00:49:08Mom, I'm going to be an intern at her.
00:49:10I'm going to get out of here.
00:49:14We want to get out of it.
00:49:17You're doing so much about it.
00:49:19If you want to go back to your job,
00:49:20then you'll come back.
00:49:20Then you're going to get out of here.
00:49:24Hi.
00:49:24How many of you are going to get out of here?
00:49:29Arn...
00:49:30...the girl...
00:49:32...two years later, you know?
00:49:34I don't know. I was going to go to the hospital.
00:49:36I was going to go to the hospital.
00:49:38I was going to go to the hospital.
00:49:39I was going to go to the hospital.
00:49:42What was that?
00:49:43What?
00:49:44Oh...
00:49:45I don't know.
00:49:46Are you hungry?
00:49:48I'm hungry.
00:49:49What is going to eat?
00:49:51I'm hungry.
00:49:54You're a victim?
00:49:56The team-related knife, then the team-by-fficking.
00:49:56I have to take it to the police.
00:49:59That was the line of the team!
00:50:00Why?
00:50:01They're very short-term and creative.
00:50:04What?
00:50:07I've never heard of you, too!
00:50:08Here's the target!
00:50:09That brings me back to the team-by-fficking team.
00:50:13It's a job!
00:50:13You're a senior team I've ever heard from the team!
00:50:15I've never heard of you.
00:50:16You know, it's kind of a team that's your team-by-fficking team.
00:50:18And you can't make the team-by-fficking team.
00:50:24It's really hard for the staff to help with the staff.
00:50:25It was so fast.
00:50:26It was so hard to do.
00:50:27What did he call me?
00:50:27That was really hard to take care of me and to get this job, when I got a man from
00:50:30the full-time laser.
00:50:34That it was a job to take care of me so he had to take care of me.
00:50:38It wasn't a lot of all I had.
00:50:44I'm going to raise your hand.
00:50:45I can't pay attention.
00:50:47It's going for you to run the job.
00:50:50It's just that I was timid, and I thought it could use my hand.
00:50:55Well, you are very good at the time.
00:50:58I'm going to have a lot of time today.
00:51:01I will be able to buy new products.
00:51:03I will be able to take care of it.
00:51:06I will be able to take care of it.
00:51:06Anyway, it's been a long time for me.
00:51:11That's right.
00:51:13And if you want to take care of it,
00:51:16you will be able to take care of it.
00:51:17It's not just the first time to take care of it.
00:51:21No, it'll not be taken care of it.
00:51:23You can't hold my favorite time on the time?
00:51:27I'll be able to take care of it.
00:51:29I'm so sorry.
00:51:34I'll be able to take care of it.
00:51:38I will stay by my own friends.
00:51:40I have been able to take care of it too.
00:51:42This time I can take care of it.
00:51:42I can take care of it.
00:51:42I can take care of it.
00:51:46I'll be able to take care of it too.
00:52:02Okay.
00:52:19I'll go.
00:52:28I'll go.
00:52:31I'll go.
00:52:32I'll go.
00:52:33Team장님.
00:52:34Yeah?
00:52:37I'll go.
00:52:38I'll go.
00:52:40I'll go.
00:52:41I'll go.
00:52:47Oh!
00:52:56신 팀장은 아까 말한 대로 빠른 시일 내에 해고 처리하기로 했고 법적 문제는 사내 변호사 대동해서 절차 밟기로 했어.
00:53:07강두준 사장님?
00:53:09절차 밟기로 했다고요.
00:53:12그래, 고소 진행되는 대로 나한테 다시 알려줘.
00:53:15오늘 일정 이게 끝인가?
00:53:17응.
00:53:18집으로 바로 갈 거지?
00:53:18뭐 그래야지.
00:53:19아, 아니다.
00:53:21생각해보니까 회식하라고 판을 깔아줬는데 내가 빠지면 섭섭해하지 않을까?
00:53:25너 설마 신제품 개발팀 회식 가려고?
00:53:28그럴까 하는데?
00:53:29나를 애타게 기다리고 있을지도.
00:53:31회식 자리에서 제일 멋있는 사람이 누군지 알아?
00:53:33카드만 주고 참석 안 하는 사장!
00:53:36아니.
00:53:38얼굴은 비추는 게 사장으로서의 예의야.
00:53:40가자.
00:53:42아니.
00:53:42예의 아니라니까!
00:53:43어?
00:53:44아무도는 기다리지 않으라고!
00:53:46야!
00:53:46야!
00:53:49근데 왜 포기했을까?
00:53:51그게 미스터리야.
00:53:52어디 아프신 거 아닐까요?
00:53:54설마?
00:53:55가산점으로 유학 간다는 오해 때문에?
00:53:56아니 그러게.
00:53:57그때 왜 팀장님 편을 들어가지고.
00:53:59어, 잠깐.
00:54:01어, 어.
00:54:02아.
00:54:03그때.
00:54:04채대리가 오해해서 미안하다고 한 잔 주고 싶대.
00:54:11아이.
00:54:12장 과장님.
00:54:14제 사..
00:54:16사과 받아줄 거죠?
00:54:22고맙습니다.
00:54:24아이.
00:54:24저도 진짜 마시고 싶은데.
00:54:26제가 요즘 한약을 먹고 있어서요.
00:54:30내 화해자는.
00:54:31거봐야 안 받는다잖아요!
00:54:33아니.
00:54:33아니 그게.
00:54:34그런 게 아니라.
00:54:35어, 쟤들이 수고했고.
00:54:36아, 근데.
00:54:37우리 진짜 궁금해서 그러는데.
00:54:39이 독일은 갑자기 왜 안 가겠다는 거야?
00:54:40아, 그동안 이것 때문에 그 난리 친 거 아니었어?
00:54:43생각해보니까.
00:54:44남아서 해야 할 일이 눈에 밟혀서요.
00:54:46꿈은 여기서도 이룰 수 있는 거니까.
00:54:50안 간다는 사람 굳이 파헤칠 건 뭐야?
00:54:54장 과장 때문에 모임 자리니만큼.
00:54:56장 과장이 시원하게 한 잔 털고 시작하자고.
00:54:59저요?
00:55:00왜?
00:55:01팀장이 주는 술인데 안 받을 거야?
00:55:06제가 대신 마실게요, 저 선생님.
00:55:08어허, 어디서 인턴 병아리가 까불어.
00:55:10장 과장, 나 팔 떨어진다.
00:55:13마셔라 마셔라 마셔라 마셔라.
00:55:18한나 쭈x4
00:55:22실전에 받는 polis reporter 손은 매쳐?
00:55:24아니, 마시는 Germans 보러 더 해버려?
00:55:27돌아버리겠네.
00:55:28요즘 또 술 강요하는 문화가 있습니까?
00:55:38오, 장cm.
00:55:45CARAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAxAME?
00:55:46Oh, that's so cool.
00:55:48Oh, that's so cool.
00:55:49Oh, that's so cool.
00:56:06It's like 284, right?
00:56:10It's so cool.
00:56:11No, it's just a little bit better than you.
00:56:15No, it's just a little bit better than you.
00:56:16No, it's just a little bit better than you.
00:56:37It's just a little bit better than you.
00:56:43It's just a little bit better than you.
00:56:52I'm going to drive a lot better than you.
00:56:53Ah, it's good.
00:56:55I'll just go to the next one.
00:57:01Why?
00:57:01I don't want to do it.
00:57:03I don't like it.
00:57:04I don't want to do it.
00:57:05Then...
00:57:06I'm going to come up with my wife.
00:57:08No, I don't do it.
00:57:11I'm going to be my wife.
00:57:15I don't want to do it.
00:57:16I'm going to be my wife.
00:57:20I'm going to be my wife.
00:57:23I'm going to be my wife.
00:57:27It's not really.
00:57:41It's good to eat today.
00:57:44How are you?
00:57:45Do you think it's good?
00:57:47I don't know what to say.
00:57:51You've been talking about two people.
00:57:52Two people?
00:57:55I...
00:57:56I'm always a set.
00:57:59It's tough.
00:58:00Why?
00:58:00You're so tough.
00:58:01It's tough.
00:58:03It's tough.
00:58:12You're a good man.
00:58:13I'm sorry, I'm sorry.
00:58:15It's tough, I'm sorry.
00:58:17I'm sorry, I'm sorry.
00:58:21It's tough.
00:58:22I'm glad we're here.
00:58:24This is a dream to ut00a.
00:58:29I'm happy to be a baby.
00:58:29I'm happy to be a baby here.
00:58:39Well, I'm not going to get married, but I'm not going to get married.
00:58:49I'm not going to get married anymore, but I'm not going to get married anymore.
00:58:54Then I'm going to go.
00:58:56It's not going to happen?
00:58:58Yes?
00:58:59I'm not going to get married anymore.
00:59:09There it is!
00:59:13Zaboo!
00:59:15Zaboo!
00:59:16Zaboo!
00:59:16Zaboo!
00:59:17Zaboo!
00:59:35I'm going to go!
00:59:37We're going to go!
00:59:39Let's go!
00:59:40Let's go!
00:59:40Let's go!
00:59:41Let's go!
00:59:41DJ!
00:59:45Let's dance!
00:59:48Now we go!
00:59:51Let's sing!
01:00:21In the morning, it's time for the night
01:00:28It's time for the two of us
01:00:32It's time for the cold water
01:00:37It's time for the past memories
01:00:41I don't know.
01:00:58You can't.
01:00:59You're still there.
01:01:01You're still there.
01:01:03I'm sorry.
01:01:03You're still there.
01:01:04I was like, hey, hey, hey.
01:01:04What do you want to say?
01:01:05Why don't you?
01:01:05I want to say you're wrong.
01:01:06If you believe that someone who's in the wrong place,
01:01:08it would be more of a pain.
01:01:10There's no reason to say anything about it.
01:01:12There's no reason to say it.
01:01:13It's very strange.
01:01:15I'll go to the hospital.
01:01:16I'll go to the hospital.
01:01:17Who would you like?
01:01:19If you think about this,
01:01:21what do you think about the person?
01:01:22How do you think about it?
01:01:25I don't think I've ever thought about it.
01:01:27Do you think I'm going to go to the hospital?
01:01:36I don't know.
Comments

Recommended