Skip to playerSkip to main content
  • 1 minute ago
CRUSH ALERT! LOVE REQUEST FROM MY ENEMY : FULL ENGLISH
Transcript
00:00:02new intimacy level unlocked new skin dangerously hot is equipped
00:00:18you're staring you like what you see maybe
00:00:30when are you gonna tell me you really are you know who i really am i'm valley queen 33. such
00:00:36a dumb
00:00:36username oh okay guacamole wizard 275 don't talk to me about dumb usernames you know you're lucky
00:00:43you're cute you don't even know what i look like oh i would if you agreed to meet me in
00:00:46person
00:00:47or at least a photo maybe someday
00:00:55crap i'm late good luck scholarship queen
00:01:02who needs luck when i have my talisman to remind me of my knight
00:01:09in the game of castle claimers i might be a warrior princess in love with a dashing knight
00:01:14but on my first day at edmund's academy i feel like a peasant
00:01:19watch it this isn't public school
00:01:23forget your training wheels at least i have my knight's charm to help me get through the day
00:01:40stop stop stop stop the car
00:01:45no god my knight's special talisman it's ruined
00:01:56he's so hot hey i told you to stop the car
00:02:04oh my god it's cold he's so hot
00:02:11hey what is wrong with you didn't you see me yelling and screaming for you to stop the car
00:02:16okay i see you now new girl what are you with me son what are you talking about
00:02:24i thought you were one of my fans no i'm not one of your fans
00:02:30you just broke something that's really important to me yeah i break a lot of hours part of cup okay
00:02:37you should know that i don't know who you are but you were a you were a
00:02:45asshole
00:02:50all right i broke something of yours sure but hey you got my attention
00:02:59so in that case we're even
00:03:07don't do it hayley have a good day
00:03:13don't do it
00:03:15i got a hot mess energy
00:03:21oh fuck now we're even my last thought better not be broken i can't lose my connection to valley
00:03:29you just paid the wrong enemy you just made the wrong enemy i'm going to make every classroom
00:03:43every hallway and every rumor in your school your personal nightmare i'm going to make your life
00:03:49living out what's going on cole's fighting the new girl now cole's leaving the new girl
00:03:55yeah idiot i can see that just met an unhinged person good thing the universe balances it with you
00:04:04same ran into a certified asshole can't wait to see you in the game tonight
00:04:12cold do you need help i can help you
00:04:16the new girl poured coffee on him this thinks that she can just roll up and piss off michael
00:04:21but he's not your coal shut up lindsay he's not yet
00:04:29hi i'm jen and this is lindsay
00:04:33hi i'm hayley so nice to meet you your first day jitters it's totally understandable
00:04:38we want to make sure you feel really welcome and so we'll take you to your locker
00:04:42come in okay let's go
00:04:48uh there you go thanks so much
00:05:12you're welcome new girl honestly it's kind of an improvement on your face
00:05:22guacamole wizard wow what are you catfishing some little lonely online gamer boy
00:05:29hold on hey if you go to edmund's academy you should come to locker 83
00:05:35right now send here now your little gamer friend can see your ugly little face
00:05:42so when can i meet the hero who ruined your billionaire shirt i'm your friend first max at least check
00:05:47on me
00:05:48oh is it the online level all right chill please
00:05:54no way what is it no valley queen goes to the school
00:06:04please ignore that someone stole my phone and played a stupid prank send
00:06:13what is wrong with you you mess with cole edmunds and you're gonna mess with me
00:06:17edmunds what you don't know that his family owns the whole school
00:06:21wow you really did crawl out of the gutter didn't you
00:06:26stop recording me jen is a new girl wait is the new girl valley queen
00:06:36there's no way the new girl is valley queen could it be jen
00:06:42ew
00:06:46your enemy is our enemy goal and i just made sure that the new girl knows that
00:06:51so
00:06:51no chances jen so is it she does look kind of cute
00:07:03please ignore that someone stole my phone and played a stupid prank
00:07:07what was i thinking of course she's not my online lover
00:07:14hey there buttercup keep walking hayley just keep walking
00:07:19you got a problem with shaving this morning or
00:07:22my name's hayley well hayley i think you uh
00:07:27needs to spell on your upper lip right there
00:07:31what a coincidence so did you oh no
00:07:37oh i'm sorry i forgot you don't even need shaving cream you're just a man child with follicle issues
00:07:47whatever ends up with her i must have failed in the eye exam
00:08:02i was so relieved to see you something happened and i lost the game i thought i'd never see you
00:08:07again
00:08:08i think it's time we call this what it is and what is this what i think it is is
00:08:15i want to be with
00:08:16you and you want to be with me as more than just friends oh thank god i honestly want that
00:08:25more than
00:08:25anything you're my soul mate like i like you so much okay well since we're dating now um
00:08:32i'm ready to send my photo wait really yeah get ready
00:08:44okay no face just the boobs is it a bad idea but all my online friends said it's cool pg
00:08:52-13
00:08:52nudes are harmless all the kids do this you'll love it
00:09:00oh this lighting hates me come on hayley confidence you literally fight dragons online
00:09:11okay yeah that's actually kind of
00:09:17oh my god seriously hello anyone
00:09:24don't look at me
00:09:28don't look at me i'm trying not for viable are we i don't think you're supposed to do it like
00:09:33that
00:09:33get out now fine
00:09:37ow damn it
00:10:15you're helping me
00:10:16i won't i didn't plan it but here we are
00:10:26excuse you these boobs are for someone else
00:10:28i don't have a boyfriend do we that is shocking yeah actually and he'd probably kill you right now
00:10:34if you saw me for flirting with me flirting yeah don't lie to yourself i've got a girlfriend too
00:10:38my thoughts and prayers to her funny okay well can we just pretend this didn't happen and go her
00:10:45to her separate ways fine by me
00:10:49oh no
00:10:50and um
00:10:51i love the purple bra by the way i like it a weird way
00:10:55i'm not even my type but you know power theory
00:10:58I don't know if I said you just get out of here
00:11:09Hopefully guacamole wizard will like it too
00:11:13Jen red alert Cole and the new girl are for sure flirting. I think it's time to take drastic action
00:11:21Don't be a coward just send it Jen
00:11:28Oh my god, here goes nothing
00:11:38Still no response don't freak out. He's probably just busy
00:11:45Give it back why you don't want me to see your slutty little nude. Oh
00:11:51This is actually a really good photo. Honestly. It's so good that I think the whole school should see it
00:11:55Did you get it Lindsay?
00:11:58Got it
00:12:01What are you doing?
00:12:31What's going on dude your enemies new just got put up on the big screen
00:12:34What's yeah
00:12:35uh
00:12:49Come on
00:12:50Let's see if these goods are photoshopped
00:12:54Stop, delete it please, delete it.
00:13:08Oh my brave knight, I wish you were here with me right now.
00:13:16Oh my god.
00:13:18Oh cool, but your enemy's kinda hot.
00:13:21Since you're so into slutty photos, why don't we just go ahead and go full nude.
00:13:28Jen no, no no no no.
00:13:30Bink! Bink! Bink! You died!responding
00:13:45for meatball6.4
00:13:48.1 My school enemy
00:13:50is my ally and girlfriend? STOP IT!avatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatatciu
00:14:06Hey, you okay?
00:14:10Give that to me.
00:14:18Now give the phone back, Jan.
00:14:20What the hell, Cole? I thought you'd be happy.
00:14:28How does it feel, being exposed to the whole school?
00:14:30Not good, huh?
00:14:31Now if you don't delete it off your phone,
00:14:33I'm exposed to what else is fake about you.
00:14:35And I know it's not just your purse.
00:14:38Why are you even defending her?
00:14:39She's the loser who has nude photos for random men.
00:14:43He's got more personality than all of you combined.
00:14:46And if you mess with her, you mess with me.
00:14:48You hear me?
00:14:53Hey, where are you?
00:14:54Cole is on my side now?
00:14:56Is he doing this to play with my feelings?
00:14:58I just need to be alone.
00:15:00Haley!
00:15:05Cole is a rich asshole.
00:15:07And he said we were enemies.
00:15:09But why did I get butterflies when he looked at me today?
00:15:15Don't stay up too late, honey.
00:15:17Love you, Mom.
00:15:19Wait, Mom.
00:15:24Do people change?
00:15:27Like, can a spoiled brat somehow become nice?
00:15:34Well, maybe just give them a second chance.
00:15:54Tough day, huh?
00:15:55There's no more mozzarella sticks in the cafeteria.
00:15:58They're my favorite.
00:16:00Noted.
00:16:00Is that all?
00:16:01The whole school treats me like I'm their punching bag.
00:16:04I'm just trying to bring a little hope to my family and keep my scholarship.
00:16:08Well, I'm really proud of you.
00:16:11And then there's this guy.
00:16:13He has this vendetta against me, but at the same time, he's super contradictory.
00:16:17It's so confusing.
00:16:18Sounds like you're into this guy.
00:16:21Sounds like you're into this guy.
00:16:22No, I'm not into this guy.
00:16:24I like you.
00:16:25Only you.
00:16:31I really liked your photo, by the way.
00:16:34You did?
00:16:34Are you going to reciprocate?
00:16:36I was thinking it would be better if we met in person.
00:16:38That sounds amazing.
00:16:40When?
00:16:41When?
00:16:41After school.
00:16:42At the balcony.
00:16:43I'll bring flowers.
00:16:45Deal.
00:16:54I'm about to meet my boyfriend.
00:17:05Stop thinking about Cole.
00:17:15Call me, father.
00:17:17I heard about you harassing Jen at school today.
00:17:19Defending that nobody.
00:17:21Haley girl.
00:17:22He was not a nobody, dad.
00:17:24Are those for her?
00:17:29What the fuck?
00:17:34I know what Haley is, Cole.
00:17:37Her mother works as a maid at my office.
00:17:39That whole family is trash.
00:17:41Stay away from her.
00:17:43And what if I say no?
00:17:44Stay away from Haley, Cole.
00:17:46Or I'll fire her mother.
00:17:48What if she found out that you were the one making her life miserable?
00:17:52I'm almost 18.
00:17:53Soon I'll have my inheritance.
00:17:54I hate to make Haley wait, but she can't know who I am before I make sure her family is
00:18:00safe.
00:18:01You're sick.
00:18:04It's called watching out for your future.
00:18:11Oh, hi.
00:18:13I am Haley.
00:18:15Yes.
00:18:16Mm-hmm.
00:18:16So nice to meet you.
00:18:18God, I'd give anything just to hear her say my name.
00:18:21But the moment she knows, I lose her forever.
00:18:26Thank you for the flowers.
00:18:28You're so nice.
00:18:33Guacamole wizard.
00:18:35Fail.
00:18:39Guacamole wizard.
00:18:40Ew.
00:18:42You're waiting for your stupid little secret boyfriend?
00:18:45Pathetic.
00:18:46Maybe he's married.
00:18:47Or maybe he's fat.
00:18:49And maybe he's sitting on his back video.
00:18:53I don't want any more trouble.
00:18:56Why is guacamole wizard still not here?
00:18:58Oh, no.
00:18:59We're not here to give you any trouble.
00:19:00We just noticed that you didn't have any lunch.
00:19:02And so we thought we would bring you a sandwich.
00:19:06Eat it.
00:19:20Call me.
00:19:21So you thought that you're going to humiliate me in front of the entire school?
00:19:26You're a maid's daughter.
00:19:27So you can go ahead and eat trash.
00:19:30Guacamole wizard.
00:19:30Where are you?
00:19:32Oh, and by the way, Nicole's not going to come save you.
00:19:35Because after all, he's rich.
00:19:37Like me.
00:19:42I'm nothing like you.
00:19:47Yeah, I'm nothing like you.
00:19:50Cole again?
00:19:51Why is he always here when I need help?
00:19:54Pick it up.
00:19:56Cole, we were kidding.
00:19:57It's ketchup.
00:19:58Pick that bloody thing up.
00:20:04Take out of your phone and record this.
00:20:13Didn't your dad tell you not to mess with Haley anymore?
00:20:15Don't think you have leverage here.
00:20:17So I'll tell your mom how fucked up you are.
00:20:19You're going to hold that thing next to your face and do what I say.
00:20:25I will leave Haley alone.
00:20:30I will leave Haley alone.
00:20:35Got it?
00:20:36Yeah.
00:20:36Let's go.
00:20:38What are you looking at?
00:20:43Got it?
00:20:44Let's go.
00:20:52Uh, thank you.
00:20:55Wow.
00:20:56Never thought I'd hear you say that.
00:21:00Why do you keep following me around?
00:21:02I just...
00:21:04I happen to see you.
00:21:06Were you waiting on someone?
00:21:08Yeah.
00:21:09My boyfriend, actually.
00:21:13Well, he...
00:21:14He kind of stood me up, so...
00:21:17Maybe you didn't do it on purpose.
00:21:20Maybe you got to do it nice today.
00:21:22Cole, are you being nice to me?
00:21:26You thought we were enemies.
00:21:28I mean, I still find you incredibly annoying, though, so...
00:21:31Am I that annoying?
00:21:32Maybe you'll like me once you realize I have layers.
00:21:35Are you trying to play with my feelings, Cole Ednaz?
00:21:37Because it's not going to work.
00:21:38I'm like those stupid, spoiled heiresses.
00:21:46How'd that online boyfriend years make you fall for her?
00:21:53He...
00:21:53He makes me feel safe.
00:21:56You wouldn't understand that, though.
00:22:02You don't understand better than you think.
00:22:05Cole understands me better than I think.
00:22:09I see...
00:22:11How you touch him like this.
00:22:22If you keep staring, I'm going to think you like what you see.
00:22:26No, no, my...
00:22:28My boyfriend has way better abs than you do.
00:22:33In the game.
00:22:35Oh, in the game, huh?
00:22:43Why does he have to smell so good?
00:22:49Are you that slow in the game, too?
00:22:53I can see why he likes you.
00:23:04I can't do this.
00:23:07I love my boyfriend.
00:23:08And you will never understand that.
00:23:10He's smart, and he's kind, and...
00:23:13He loves me for who I am.
00:23:16That is so much more important to me than whatever this is between us.
00:23:21I wish I could just tell her right now.
00:23:22I don't know.
00:23:30Wait.
00:23:31It couldn't be.
00:23:34Cole, what was that notification on your phone?
00:23:39There's nothing.
00:23:40Cole, who are you?
00:23:44What was that notification on your phone?
00:23:46It was my dad telling me my car got done getting waxed.
00:23:51Champagne problems, huh?
00:23:54You live such a tough life.
00:24:00What was I thinking?
00:24:01We are from two different worlds.
00:24:03He just wants to play with me.
00:24:05But why did I want to kiss him so badly?
00:24:12Why didn't you come to school today?
00:24:14I got into a car accident.
00:24:16Really?
00:24:17Are you okay?
00:24:18You have to keep me in the hospital till prom.
00:24:20He was right.
00:24:21Who?
00:24:22Nobody.
00:24:23Which hospital are you staying at?
00:24:24I want to come visit you.
00:24:26No, no, you can't.
00:24:27I look miserable now.
00:24:28You need to see me in style.
00:24:31Fine, if you say so.
00:24:32So, are we going to prom together?
00:24:35Hell yeah, we are.
00:24:41Why would anyone want to sit next to her?
00:24:44Whoever needs a charity case.
00:25:01Oh.
00:25:02You.
00:25:03Oh, me.
00:25:04Why is she so lucky?
00:25:06Cole's never been this way with any other girl.
00:25:09People think you're really lucky to be my lab partner.
00:25:12I'm sure you feel really lucky to be my lab partner.
00:25:14Because you don't do any homework.
00:25:21You finished it?
00:25:23It's okay.
00:25:24We'll get to know each other more.
00:25:26I'm not that curious about you, actually.
00:25:27I'm curious about you, though.
00:25:29Like, uh, how close were you with your mom?
00:25:33What is he trying to do?
00:25:35It's none of your business, but I'm very close with my mom.
00:25:38I'd kill anyone who hurts her.
00:25:43Does Cole genuinely want to know me?
00:25:54So, are you going to prom?
00:25:56I don't know.
00:25:56I did a well.
00:25:57I don't know.
00:25:58So, you have a date.
00:26:01Or shall I say victim?
00:26:03Are you jealous of me?
00:26:04Me?
00:26:05Jealous?
00:26:06No, why would I be jealous?
00:26:07Oh, because I think you so secretly want me.
00:26:10You are so full of yourself.
00:26:12You can do this on your own.
00:26:13Yeah.
00:26:16No way.
00:26:18It's a self-locking door.
00:26:20Really?
00:26:21This woman's going to be back in an hour.
00:26:22I'm sure you'll be fine.
00:26:23I'm stuck here with you for a full hour?
00:26:25No.
00:26:26Sorry.
00:26:27Am I that bad?
00:26:28I think maybe we can pick up where we left off.
00:26:31Or maybe trust me and do.
00:26:33Mm-mm.
00:26:34We're keeping our distance this time, actually.
00:26:36Yeah.
00:26:46That was my first kiss.
00:26:50My first kiss was not supposed to go like that.
00:26:53It was supposed to be special at prom and not just bumping lips.
00:27:07You're really good at this.
00:27:09My dad won't hear regret it.
00:27:11You know, we can do more if you want.
00:27:29Anyway, I've been wanting back a lot more than you think.
00:27:32So you want me?
00:27:36I think you know how much I want you.
00:27:42Do you want me?
00:27:45I want you.
00:27:50Oh, shit.
00:27:54Anyone in here?
00:27:58Oh, my God.
00:27:59How long have you two been in here?
00:28:01I really need to change this lock.
00:28:02Are you two okay?
00:28:04Oh.
00:28:05Yeah.
00:28:05Yeah, we're good.
00:28:06We're okay.
00:28:07Great.
00:28:08Nice.
00:28:15You're just going to pretend like that didn't happen?
00:28:17What didn't happen?
00:28:18Hey, wait.
00:28:19It's just hormones.
00:28:21Jake.
00:28:23Can you still play after your accident?
00:28:25Relax, I'm not dead.
00:28:26Wait, car accident?
00:28:28Guacamole wizard?
00:28:35I gotta go.
00:28:43Guacamole wizard?
00:28:44Huh?
00:28:47Are you all better after your car accident?
00:28:49Do I know you?
00:28:51Why is he being so standoffish?
00:28:53Is he trying to give me a surprise?
00:28:55Er, he heard something about Cole?
00:28:58You're crushing your soda can.
00:29:01She thinks guacamole wizard is Jake Myers.
00:29:03She was in a real car accident.
00:29:05According to you, so is guacamole wizard.
00:29:08I can't take this anymore.
00:29:09Cole, wait.
00:29:12Oh, shit.
00:29:17What's up, guys?
00:29:18Um, we were just chatting.
00:29:21Chatting about Jake's grand plans to kick balls?
00:29:24Was there something that you wanted, Cole?
00:29:28Hey!
00:29:29I just figured I'd bring you some mozzarella sticks.
00:29:32They're your favorite, right?
00:29:35How did you know that?
00:29:37Tough day, huh?
00:29:38There's no more mozzarella sticks in the cafeteria.
00:29:40They're my favorite.
00:29:42He couldn't be Cole.
00:29:44Could he?
00:29:50The truth is, um...
00:29:51A dickhead?
00:29:54What do you honestly get out of here, bro?
00:29:55You came to my table, bro, and knocked my ball away.
00:30:05There it goes again.
00:30:06Cole is jealous.
00:30:08We got a problem here, Cole?
00:30:10We don't have a problem.
00:30:11We don't have a problem.
00:30:13Right?
00:30:14Tell Cole to get my ball, and we don't have a problem.
00:30:17Jake, it would take me forever to find one of your balls.
00:30:22I have the ball now.
00:30:23Can we stop measuring each other's dicks?
00:30:27Cole and Jake are fighting over Haley?
00:30:30Maybe I can use that.
00:30:34Jake!
00:30:35Hey!
00:30:36What if I told you that I have an internship opportunity for you with my dad?
00:30:40Wait, seriously?
00:30:41Yeah.
00:30:42Just one little catch.
00:30:43You have to pretend to like Hallie Roth.
00:30:47All right, you have the rest of the period to work on your lab reports.
00:30:50If you have any questions, I'll be at my desk.
00:30:54I thought Guacamole Wizard would feel more like Cole.
00:30:58But if he's really Jake, then maybe this was always going to end.
00:31:02You've literally been sorry for five minutes.
00:31:04I'm thinking.
00:31:05About the report or about him?
00:31:06Why are you making it so weird about Jake?
00:31:08We literally made out of a sore dream.
00:31:11Maybe I've known Jake longer.
00:31:13No, you don't.
00:31:14How do you know that?
00:31:15You're going to prom with someone else.
00:31:17Stop acting like you're serious about me.
00:31:19You have no idea.
00:31:22I don't know.
00:31:23I don't know.
00:31:24I don't know.
00:31:24I don't know.
00:31:24I don't know.
00:31:25Oh my god, is Jake asking me to prom?
00:31:41Hallie, someone's here to see you.
00:31:54are you asking me to prom too cheesy no it's cute the accident the mozzarella sticks
00:32:03he is guacamole wizard so um what do you think you want to go to prom with me
00:32:10i i should feel happy but why does this feel so wrong hey can we not
00:32:21hey can we not dude seriously what is your problem my problem here dude is that me and
00:32:26my lab partner have work to do and you're out here to strike me with bad puns wow that
00:32:32is some weak shit man oh that's weak shit is this weak shit
00:32:48wow he's got really pretty eyes
00:32:56wait i can't cool put me down put me down put me down
00:33:02don't do that again
00:33:16new couple alert
00:33:18fuck off jen why do you hate me so much gull you and i we're not that different and if
00:33:23you'd
00:33:23realize and give me a chance i think that we would make a great match
00:33:27like say if you asked me to prom i might say yes
00:33:34jen you want to go to prom with me jen you want to go to prom with me we're
00:33:40both hot and we're both rich and our dads have been in business like forever so
00:33:46how romantic i think i'll pass you're gonna regret this call admins
00:33:57if i message corcamole wizard i wonder if jake's phone were ding
00:34:03what should we wear to prom and the dean's list
00:34:15i'll talk to you later i'll see you around school okay okay yeah i'll see you later bye
00:34:20he's so different maybe he's still recovering from the accident
00:34:50you're scared of me seeing all the girls in your phone i don't care i do
00:34:54care
00:34:56hell yeah
00:34:57i mean he only knows you like mozzarella sticks because of me he doesn't even know you
00:35:19and you do how do you know i like mozzarella sticks that's something i've only ever talked
00:35:24because i pay attention to what you like i noticed it at lunch the first day you were watching me
00:35:34just don't go to prom and shake
00:35:51move
00:35:53colt is talking to hayley again your job is to keep them away from each other jake unless you don't
00:35:58want
00:35:59that internship that my dad got you obviously i do okay then break them up idiot
00:36:04uh what do i do
00:36:08i've got a few ideas
00:36:13hey look
00:36:16someone will take you to prom all right i promise
00:36:18yeah really like who i mean the whole school hates me except for jake
00:36:24and you but you're not asking me
00:36:28hey
00:36:28oh hey jake
00:36:30hey how um i just wanted to thank you again for the other night
00:36:37the other night
00:36:38yeah it was
00:36:40so
00:36:41sexy
00:36:43you're so sexy
00:36:44jake what are you talking about
00:36:46i hate to break it to you asshole but she's my prom date
00:36:57and she's a real tiger in the pep room
00:37:01oh shit look
00:37:02oh shit
00:37:25oh shit it's principal stevens i've got to save cole i mean jake i've got to save jake
00:37:37oh my god
00:37:39principal stevens i'm so sorry
00:37:42hayley rock
00:37:43that's detention
00:37:45after school
00:37:46don't be late
00:38:03calm what are you doing here
00:38:05can we keep you company
00:38:08it's the least i could do if you saved my rest today
00:38:11the locker thing that was an accident
00:38:14oh sure
00:38:17so uh you and you and jake huh
00:38:21no
00:38:23he lied about that i don't know why though
00:38:26good
00:38:27you know
00:38:29father that asshole every time he looks at you makes me sick to my stomach
00:38:33thinking about him touching you kissing you
00:38:36i could kill him
00:38:40promise me you won't go to prom with it
00:38:45okay fine
00:38:46i won't
00:38:49because i want to go to prom with you
00:38:54okay everyone let's start off by mixing our sodium bicarbonate
00:39:04oh my god i am so fed up with this
00:39:19ohop
00:39:25sorry
00:39:26i tripped
00:39:27no
00:39:28no no no no
00:39:29jett
00:39:29what
00:39:30it always has to be about her doesn't it
00:39:36they're dead they're both dead oh how am i going to be able to talk to guacamole wizard
00:39:46oh what are you are you almost crying it's probably because you can't afford a new one
00:39:53jen what's going on over there
00:40:05now what's going on is jen is getting a taste of her own medicine
00:40:10mr edmunds oh please it's baking soda and water you're fine detention today after school
00:40:29jake hey oh uh sorry gotta get to student council
00:40:36hey you didn't even try the rice trick the rice trick
00:40:44yeah you don't know about the come on
00:41:00hey um ella it's emma yeah that's what i said can you hack a broken laptop
00:41:16hey it's gonna be okay we'll pour out in a few more minutes and it'll be like the whole
00:41:22thing never happened no it's not just the phone or the laptop it means it means i can't can't what
00:41:32i talked to a friend online he's really important to me
00:41:39and i'm sure you're really important to him
00:41:52you know cool if you look past all that hair gel and big ol ego and rich kid bravara
00:41:59okay okay i i get it
00:42:04you're kind of sweet
00:42:10hey look at that oh my god thank you
00:42:15oh my god you're a miracle worker
00:42:24oh what is taking so long you doused this thing in sodium bicarbonate
00:42:28shut up ella it's emma whatever
00:42:37oh my god
00:42:45oh morning valley whore
00:42:48how are things in the castle
00:42:55valley whore what are they talking about
00:43:12guacamole wizard when can we be together in person guacamole wizard i want you so badly i dream about you
00:43:19touching me
00:43:19oh my god someone hacked my castle claimers messages
00:43:23oh my god someone hacked my castle claimers messages
00:43:23touch me guacamole wizard
00:43:26yeah hey valley whore show them what you really like
00:43:48here you go
00:43:49here this is for you
00:43:55oh do you like what i've done with the place
00:43:56you hacked my laptop
00:43:59oh no it wasn't me
00:44:00it was that kid ella
00:44:02but i definitely gotta reap the benefits
00:44:04what kind of incel sex over a video game
00:44:07hayley
00:44:07what are you catfishing this guy
00:44:09no i'm not trying to catfish him
00:44:11hey everyone
00:44:11i think valley whore is a catfish
00:44:15because who in their right mind would spend their time thirsting over you
00:44:43stop it stop stop
00:44:48i thought i'd send the janitor some time
00:44:53jake
00:44:54hey
00:44:57now's the time
00:44:58tell them
00:44:59tell them what
00:45:00that you're guacamole wizard
00:45:04who's guacamole wizard
00:45:07here you go
00:45:10oh my god
00:45:11did you think that jake was your secret little online boyfriend
00:45:14oh sweetie i've been bribing him this whole time to pretend to like you
00:45:18what
00:45:19why would you do that
00:45:20oh i don't know cole why do you think i would do that
00:45:25jake is this true
00:45:26have you been pretending to like me this whole time
00:45:30sorry
00:45:31it was nothing personal
00:45:38yeah nothing personal
00:45:41oh
00:45:42oh
00:45:44oh
00:45:44oh
00:45:46all right
00:45:47all right
00:45:47all right
00:45:48enough
00:45:49what in the world is going on here
00:45:51is that a leaf blower
00:45:53that's all him
00:45:53okay well you both have detention so
00:46:01let me get this straight
00:46:02you stole a leaf blower
00:46:04and defaced school property
00:46:06it wasn't school property dad
00:46:08it was jen's cyber boy spreadsheets
00:46:10jesus
00:46:10how does she always get away with this shit
00:46:13could it be because her father's running for senate call
00:46:15you think that's what it could be
00:46:17who cares
00:46:18i care
00:46:19and
00:46:20i hear she's got an eye for you
00:46:23so you're taking her to prom
00:46:24what
00:46:25not over my dead body
00:46:27oh because you're like that hailey girl
00:46:30i'm firing her mother right now
00:46:32no no please don't
00:46:33please
00:46:34please
00:46:34then you're taking jen to prom
00:46:36max's dad called
00:46:37he said he's having a party tomorrow
00:46:39you're gonna go
00:46:40and you're gonna ask jen to prom
00:46:42end of discussion
00:46:49come on you big coward
00:46:50message him
00:46:52just do it just do it
00:46:56you must think i'm the biggest idiot
00:47:04you must think i'm the biggest idiot
00:47:05i could never think that
00:47:12but i thought you were jake
00:47:13please can't you just tell me now
00:47:15i think i've had enough public humiliation for one lifetime
00:47:22i heard that guy max is throwing a party tomorrow
00:47:24if you want i'll meet you there
00:47:37okay
00:47:38okay
00:47:38you got this haley
00:47:40just take a deep breath
00:47:42you got this
00:47:43you got this
00:47:47you look beautiful
00:47:50thank you mom
00:47:52thank you mom
00:48:10hey haley
00:48:11i'm glad you came
00:48:13you look so pretty
00:48:14hi
00:48:15hey max
00:48:16your house is
00:48:17gorgeous
00:48:18i mean
00:48:18no it's just my parents blood honey
00:48:20you know they're upstairs watching the last of us right now
00:48:22they don't care about shit
00:48:23get drunk girl
00:48:24woo
00:48:25woo
00:48:27yeah
00:48:28yeah
00:48:38what are you doing here
00:48:40valley whore
00:48:42looks like the catfish came out of the pond
00:48:45hey everyone let's give it up for valley whore
00:48:48valley whore
00:48:52jen
00:48:53why are you doing this
00:48:54what have i even done to you
00:48:55to me
00:48:56oh i'm actually concerned about our whole community
00:48:59because those little cringy messages on your castle game
00:49:02those are concerning
00:49:03actually i kind of feel a bit of a perv
00:49:06did you know that
00:49:07haley
00:49:08she's a little pervy princess
00:49:09pervy princess
00:49:13pervy princess
00:49:14pervy princess
00:49:16pervy princess
00:49:18hey
00:49:19let's get pervy tonight
00:49:21leave me alone
00:49:23is there a fire?
00:49:25okay we set off the alarm
00:49:39Paul?
00:49:58the fire
00:50:01we got the fire
00:50:04so we're able to come together
00:50:08we get to the fire
00:50:08we're able to go
00:50:13we'll be able to get through today
00:50:14so we'll be able to go
00:50:17Are you him?
00:50:20Would you stop trying to find your stupid little cyber boyfriend?
00:50:23Okay, Cole is not him.
00:50:25Anyways, we are going to the prom together.
00:50:28No, I'm not.
00:50:29Yes, you are.
00:50:30It's okay.
00:50:31You can be honest about your feelings.
00:50:34So you too.
00:50:35This whole time.
00:50:39Oh my God, I am such an idiot.
00:50:42Hey, wait.
00:50:43Wait.
00:50:49Please, at least take my jacket.
00:50:51You know, if you really wanted to humiliate me, you didn't have to go to the extra effort.
00:50:54Jen was doing just fine.
00:50:56I wasn't trying to humiliate you.
00:50:57Then what were you trying to do?
00:50:59I guess you.
00:51:00Obviously, the white clothes were just an added bonus.
00:51:03I knew I shouldn't have trusted you.
00:51:06Now, what about guacamole, wizard?
00:51:09What are you?
00:51:18Who is that?
00:51:19I don't know.
00:51:20Just the devil.
00:51:23Get in the car.
00:51:26I'm not going to ask you again, Cole.
00:51:28Get in the car!
00:51:29Dad, can you just act normal for once and please introduce yourself to-
00:51:32Haley!
00:51:33I already assumed that's who this was.
00:51:36I'm a stripedance.
00:51:37So, you're the scholarship trash that's hell-bent on ruining Cole's life?
00:51:43Well, I've got news for you, young lady.
00:51:45My son is going to marry a good girl from a respectable family.
00:51:50And that's not you.
00:51:51You will be forgotten.
00:51:53You're a maid's daughter.
00:51:55And your mom works for me.
00:51:57Stay away from him.
00:51:59Or I swear to God, your mother is fire.
00:52:03Dad, stop!
00:52:04Don't you touch my family.
00:52:06I'll stay away.
00:52:09Haley, come on.
00:52:09You don't mean that.
00:52:12I hate everything you stand for.
00:52:15I hate your greed and your callousness
00:52:18and your elitist ideas of what you think a good person looks like.
00:52:21I hate everything about you.
00:52:23I hate all of it.
00:52:25I don't want any part of it.
00:52:27So, Cole, go with your dad.
00:52:32Haley!
00:52:36Fuck this.
00:52:37Fuck this.
00:52:40No laptop and no phone for a week.
00:52:43Ever since mom died, you've turned into this co-patriarch.
00:52:46Haley, not dad's real love.
00:52:47Why do you have to make me so miserable?
00:52:49I promised your mother I would make you a success, son.
00:52:53Even if it meant saving you from yourself.
00:53:03Hi, Haley.
00:53:04I'm Emma.
00:53:05I know who you are.
00:53:06Right.
00:53:07I just felt kind of bad that I accidentally helped Jen ruin your life.
00:53:12So, I wanted to return your laptop to you.
00:53:15Goodness new.
00:53:20Oh, wow.
00:53:22Thanks, Emma.
00:53:23Okay, bye.
00:53:29One down, one to go.
00:53:31You're so cool.
00:53:33I know, Emma.
00:53:34Want to go to prom?
00:53:36Why not?
00:53:38Let's get these lovebirds together.
00:53:44Hi, Mr. Edmundsons.
00:53:46Hi, Max.
00:53:47And Max's friend.
00:53:48Sorry, we weren't expecting you.
00:53:50Cole's grounded.
00:53:52Oh, he is?
00:53:54But it was his 18th birthday today.
00:53:56What can I say, Max?
00:53:58Actions have consequences.
00:54:00Birthday or no, Cole is grounded.
00:54:03Well, that really sucks because he's also the president of the prom committee.
00:54:08We were supposed to review budgets today.
00:54:11Cole?
00:54:12My son, Cole?
00:54:14Reviewing budgets.
00:54:15He's never reviewed a budget a day in his life.
00:54:18Well, Mr. Edmunds, today could be that day.
00:54:20And we just have to give him back this school-sanctioned laptop so we can get back to his very
00:54:23important and very respectable budgetary work.
00:54:35Go away!
00:54:40Max, what are you guys doing here?
00:54:43Happy birthday, Cole.
00:54:44I brought you my laptop and logged into your Castle Claimers account.
00:54:47Just get it back to me by tomorrow.
00:54:49What? What's going on?
00:54:51Dude, it's your 18th birthday.
00:54:53You can tell Haley who you are now.
00:54:54You can be together.
00:54:56Just log into this stupid game and tell the girl who you love who you really are.
00:55:00No.
00:55:01I'll tell her myself.
00:55:03Stick me in your car.
00:55:11Welcome to the wizard.
00:55:14Mom, I'm fine.
00:55:16I just need some time alone.
00:55:25Open the door.
00:55:27Wait, what?
00:55:29He's here?
00:55:37It's you.
00:55:39I should have given you this to you a long time ago.
00:55:43Haley, I wanted to tell you who I was from the bitter beginning.
00:55:46My dad threatened to fire your mom and I had to wait a really long time to tell you who
00:55:51I was.
00:55:51I got my hair in this.
00:55:53And I can protect you and your family and so you don't have to choose.
00:56:08Haley, I understand that this changes things.
00:56:13If you don't love me the way you love guacamole wizard, but I need you to know I love you.
00:56:32Nicole, I love you.
00:56:34You do?
00:56:36Yes, you idiot.
00:56:38I've loved you for months.
00:56:40I mean, this whole guacamole wizard thing was so confusing though, because I had to be loyal to him.
00:56:46But you're him.
00:56:48You didn't expect her.
00:56:50I mean, I always hoped it was you.
00:56:55Until you hoped it was you.
00:56:57Yes.
00:56:58I hoped it was you.
00:57:00You were always there for me.
00:57:04You're hot and you're really fucking hot.
00:57:07I mean, I don't know, but I think it was racist for certain sake of witnessing.
00:57:22I love you.
00:57:27I'll be on you, just be on me.
00:57:32I'll be on you.
00:57:39Just be on me.
00:57:45Okay, so what do you think?
00:57:49Ten out of ten.
00:57:50Yeah.
00:57:50Yeah, we'll do again.
00:57:52Okay, sex with sex with me specifically.
00:57:55I've only ever had sex with you specifically.
00:57:58All right, all right, that's fair.
00:58:00I'll take that as a win.
00:58:07What is my life now?
00:58:09Am I being nice to Cole Edmonds?
00:58:11Oh, God, no.
00:58:12I fully expect you to continue to berate me endlessly.
00:58:17No, I'll just, I'll just lust behind it.
00:58:20There's always been lust behind it.
00:58:22I'll see you in a minute.
00:58:23Stop it.
00:58:26Um, same.
00:58:29Isn't promenade?
00:58:31I think you know if it's promenade.
00:58:34Okay.
00:58:35But the real question is, do you got a date?
00:58:40Cole, are you asking me to prom?
00:58:42Oh, I would have asked you earlier, but Jay kind of gave me to the gym.
00:58:46Oh, God, please don't mention his name again.
00:58:48I don't want to hear it.
00:58:50Yeah, you don't have to ask me twice.
00:58:52But I don't even have a dress.
00:58:54Later.
00:58:59I just slept with Cole Edmonds, and I'm in love with Cole Edmonds.
00:59:03Who would have guessed?
00:59:07I thought only the best for my princess.
00:59:11Where did you get that?
00:59:13Uh, I might have gotten you a dress on the off chance that you might have wanted to go to
00:59:20prom with me and maybe had nothing to wear.
00:59:24Of course I'll go to prom with you.
00:59:31Mr. Edmonds, I didn't expect you to be here.
00:59:34Cole, are you here?
00:59:37Cole, are you here?
00:59:40Mr. Edmonds, you can't just park into my house like this.
00:59:43I see you, Cole.
00:59:44You are a big pro.
01:00:01Hey, uh, you almost done in there?
01:00:05You try changing into an evening gown in a bunch of thorny bushes.
01:00:10Okay, I'm ready.
01:00:22What do you think?
01:00:27My God, Haley, you are the most beautiful thing I have ever seen.
01:00:32Uh-uh-uh.
01:00:34I just hunched over in a car mirror to do this lipstick.
01:00:36You're not messing it up for at least 20 minutes.
01:00:3920 more minutes.
01:00:41I want 10.
01:00:42I do.
01:00:45Thank you all for using the prom voting site to cast your votes.
01:00:50I hear we have a winner.
01:00:53And your 2026 prom queen is...
01:00:58Jen Longfellow.
01:01:00Oh, thank you.
01:01:02Oh, my God.
01:01:04Thank you guys so much.
01:01:07Seriously, this makes the world to me.
01:01:08I mean, like, who else would win, right?
01:01:12Oh, this is just the perfect moment.
01:01:18Oh, my God.
01:01:19That's Haley and Cole.
01:01:22It was fun.
01:01:23It's very too bad.
01:01:28Hey, or, uh...
01:01:30Most time that's up.
01:01:31No.
01:01:32But who cares?
01:01:42I am the queen, okay?
01:01:44She's just a little pervy princess.
01:01:46Come on.
01:01:47Everyone say it with me.
01:01:49Pervy princess.
01:01:50Pervy princess.
01:01:51Pervy princess.
01:01:57Wait.
01:01:58Wait, wait, wait.
01:01:59What are those?
01:02:00Those are texts between me and my dad.
01:02:01Make Cole Edmonds fall in love with you.
01:02:05His dad's month is essential to funding my campaign.
01:02:09Don't worry, Daddy.
01:02:11If I can't have him, no one can.
01:02:14I'm gonna destroy Haley Roth's life.
01:02:17Is this real?
01:02:18Jen's crazy.
01:02:21Who did this?
01:02:22Who did this?
01:02:26What?
01:02:26You exploited me for a hacking job
01:02:28and didn't think I was gonna hack your phone?
01:02:30You little shit.
01:02:32You know, Jen,
01:02:34as the principal,
01:02:35I'm supposed to remain impartial
01:02:37and above all of this petty drama.
01:02:41But quite frankly,
01:02:43you are the worst.
01:02:45And I think it's time
01:02:47that you are expelled from Edmonds Academy.
01:02:49You can't do that!
01:02:51I'm the principal,
01:02:52so, uh,
01:02:53yes, I can.
01:03:02There was no internship.
01:03:05You lied to me!
01:03:12Haley, catch.
01:03:18Oh, my princess finally has her crown.
01:03:22Now all I need is my handsome prince.
01:03:24Oh, yeah, no can do.
01:03:27All I have to offer
01:03:29is a Bowie Knight
01:03:29with a chip on his shoulder
01:03:31and an awesome sense of humor.
01:03:33Ooh.
01:03:34How can I refuse?
01:03:41Oh, no, that's my dad.
01:03:45We are going home right now.
01:03:48You've disobeyed me for the last time, boy.
01:03:50Yeah, I'm not a boy, Dad.
01:03:53You talk all the time
01:03:54about wanting a man
01:03:55that's worthy of the family last name.
01:03:57Yet,
01:03:58you can't see I've already become that man.
01:04:01And it's because of Haley.
01:04:03And you can accept that,
01:04:04or I'll make my own path.
01:04:06And best believe me, I can.
01:04:08I'll say this.
01:04:10It's the most backbone
01:04:11I've ever seen in you, Cole.
01:04:15Joy prime.
01:04:23I am so proud of you.
01:04:26I kind of done
01:04:27without you being by my side.
01:04:30That was terrifying.
01:04:31It's not like we haven't
01:04:32slayed a dragon before,
01:04:34well, so...
01:04:36I love you, Bella Quinn.
01:04:37I love you, guacamole wizard.
01:04:40Oh, my God, I gotta change that username.
01:04:42Yeah, you do.
01:04:42Hey.
Comments

Recommended