Skip to playerSkip to main contentSkip to footer
  • 7 weeks ago
That Makes Two Of Us Full Hd S
Transcript
00:00:00The air of the varagal group.
00:00:04Oh my gosh, he's so hot.
00:00:06I would die a million times if that means I could touch those muscles.
00:00:10Just once.
00:00:12Water scarcity and clean access.
00:00:15Alice.
00:00:17What the fuck are you doing here?
00:00:19Get out of my way, doormat.
00:00:23What are you doing?
00:00:27What am I doing?
00:00:30Look how pathetic she is.
00:00:36I have an idea.
00:00:37Why don't we light her hair on fire?
00:00:39It'll be fun.
00:00:41Max?
00:00:42No, stop, stop.
00:00:45No, please.
00:00:46No, stop.
00:00:49Stop it, let her go.
00:00:51No, Max.
00:00:53It's so nice to finally meet you.
00:00:54I'm Anna.
00:01:21My name is- It's no big deal.
00:01:24Take care.
00:01:33Can you tell he has no interest in you?
00:01:36Well, he's clearly not interested in you guys either.
00:01:50What the hell, you can't touch her!
00:02:08Let's go, ladies.
00:02:13Stop dreaming.
00:02:15Guys like him will never be interested in someone like me.
00:02:20What? Why do I need to marry your friend's daughter?
00:02:24So what if her father helped you out?
00:02:26It doesn't have to destroy my life!
00:02:28It's not like that, Max.
00:02:30Mr. Taylor's daughter is a lovely girl.
00:02:33You'll like her.
00:02:35The marriage will benefit both sides.
00:02:38If you want to give up your inheritance right to the Veragold Group,
00:02:41feel free to ignore us.
00:02:50Oh, fucking asshole!
00:02:56Hey, who threw that phone?
00:03:00Oh.
00:03:01Sorry, boss.
00:03:09Mom, what if he doesn't like me?
00:03:12I mean, should I really be marrying someone that I don't even know?
00:03:15Oh.
00:03:16Do this for me, Alice.
00:03:18Please.
00:03:20Things have been tough since your-
00:03:23Since we lost your father.
00:03:28And from now on, we're going by my surname.
00:03:32So, you won't be Alice Taylor anymore.
00:03:36You'll be Alice Smith.
00:03:38What?
00:03:39No.
00:03:40It's how it has to be, Alice.
00:03:43We need the Brown support.
00:03:46Please.
00:03:54Okay.
00:03:55I'll do it for you, Mom.
00:04:05Boss.
00:04:06I suggest you take these.
00:04:08For what?
00:04:10Well, if this woman isn't what you want,
00:04:11then better not let her see your face and fall in love.
00:04:17Good idea.
00:04:25So, seeing as we are already married,
00:04:36maybe we should go grab a coffee and get to know each other?
00:04:43Are you serious?
00:04:44Who is this guy?
00:04:55Who is this guy?
00:04:59Well, quickly, sir.
00:05:00We don't want to be late.
00:05:15Congrats.
00:05:22When will he arrive?
00:05:23Don't worry, Alice.
00:05:24It must be a traffic jam.
00:05:26He will come soon.
00:05:28What?
00:05:29Come back now!
00:05:31Don't you know today's your wedding?
00:05:33My flight to Australia is leaving in ten minutes.
00:05:35And I already signed the contract papers.
00:05:37You got what you wanted, Dad.
00:05:39Goodbye.
00:05:44So pathetic.
00:05:46I heard the bride's father recently passed away
00:05:48and she's marrying him just to save her family financially.
00:05:51The groom probably figured out her tricks and ran away.
00:05:54Who wants to marry a gold digger, anyway?
00:06:08You said you never beat your wife, Mr. Carter.
00:06:11Let's welcome our investigator, Miss Alice Smith, then.
00:06:14These are just some of the graphic images of my client after a particularly hostile exchange with the defendant.
00:06:31And might I add, Mr. Carter, that your bedroom window opens up into the living room of your neighbor's house?
00:06:49Who just so happens to be a photographer?
00:06:52A photographer.
00:06:59I would consider my career and reputation if I were you, Mr. Carter.
00:07:02Henry, you know any marriage investigators in the city?
00:07:17Why an investigator?
00:07:19I thought you were going to find a lawyer, directly.
00:07:21We're going to need some proof first.
00:07:24You know, this case is dumb time to swing in favor of the husbands.
00:07:26Not to mention if that woman gets greedy and tries to take everything from us.
00:07:30That makes sense.
00:07:32Well, I heard the best investigator here is a young lady named Alice Smith.
00:07:37Hmm.
00:07:38This is Alice Smith.
00:07:42Huh.
00:07:44Huh.
00:07:54Huh.
00:07:55What the hell's going on?
00:07:56Well, sorry, lady, but you stopped all of a sudden.
00:07:59I don't have time for this. Here, take my card, and we'll figure it out later.
00:08:03And next time, watch where you're going.
00:08:06Huh.
00:08:09So it's our fault.
00:08:11That's interesting.
00:08:16Alice Smith?
00:08:22Max, why don't you meet that woman and decide if you want a divorce or not?
00:08:26Maybe you'll like her.
00:08:27That sounds like the last thing that I want to be doing.
00:08:30Well, how do you know?
00:08:32Because I'm not interested in meeting someone who uses marriage as a tool?
00:08:35Are you sure that's what she's doing?
00:08:39Is there any other reason that a woman would marry somebody that they don't even know?
00:08:43Hmm.
00:08:44Make sense.
00:08:45Ugh!
00:08:50You're ruining my life, Alice!
00:08:53I can't live without my wife!
00:08:55Just calm down, okay?
00:08:56I'm just doing my job.
00:08:58Besides, you should know that an unhappy marriage ends in a grave for one or both parties.
00:09:02I don't give a damn!
00:09:03Stay out of my marriage!
00:09:05You're ruining everything for me!
00:09:06But go with me or I'll call the police!
00:09:09What the fuck is going on?
00:09:12Hmm?
00:09:14Leave the lady alone.
00:09:15What if I say no?
00:09:18Oh!
00:09:20Ow!
00:09:22Ow!
00:09:23Ow, you're hurting me!
00:09:24Get out.
00:09:32What are you guys doing here?
00:09:45Allow me to formally introduce you to...
00:09:49This is Max Brown, the CEO of Legend Group.
00:09:52And I guess you are Miss Alice Smith.
00:09:56Who would have thought you're the investigator we're looking for?
00:09:59Thank you for your help earlier.
00:10:02Please, take a seat.
00:10:03Could Max be...?
00:10:04No.
00:10:05My husband's company is Variable Group, not Legend Group.
00:10:21Mr. Brown, I already have my fair share of clients and headaches.
00:10:27Especially after this morning, now I have to go to the car shop.
00:10:30So, why should I take your case?
00:10:33Well, let's not allow past conflicts to cloud your judgment.
00:10:37As you said, an unhappy marriage is a grave.
00:10:45Okay.
00:10:46I'll take your case.
00:10:48Really?
00:10:50Yes.
00:10:51I believe everyone deserves a fair chance.
00:10:54So, tell me about your wife.
00:10:57Why do you want to get the divorce?
00:10:58What's the main issue in the relationship?
00:11:01I just don't know anything about the woman.
00:11:03You know, my parents arranged the marriage years ago.
00:11:08Interesting.
00:11:10Well, have you given any thought to how you want to divide up the property?
00:11:14Yes.
00:11:16I have set aside ten million dollars.
00:11:19If she requests anything else, I'm prepared to take care of it.
00:11:23That's very generous.
00:11:25You may not need my help.
00:11:29Now, hold on.
00:11:31We've been married for four years now.
00:11:33It's a dead marriage.
00:11:34For all we know, she's planning something.
00:11:37Four years.
00:11:38What was the name of your wife?
00:11:41Oh, her...
00:11:44The name...
00:11:47Her name...
00:11:48Oh, I'm sorry.
00:11:49I need to take this.
00:11:51Hello?
00:11:53Alice?
00:11:54Max has just returned.
00:11:55Come to my home and I'll introduce you guys.
00:11:58Okay.
00:12:02I have an emergency that I need to handle, so I will take a look at your case and I'll get back to you later.
00:12:11Not that professional, is she?
00:12:14I think you should ask for more detailed information from your mom first.
00:12:18Yeah, let's do it.
00:12:23Mom, please. I have no interest in this woman.
00:12:26Give it at least a month.
00:12:28By then, if you still want a divorce, I'll agree.
00:12:32Deal.
00:12:40Hi, Emma.
00:12:49Come on in, Allie.
00:12:50You look gorgeous.
00:12:52Max is waiting for you.
00:13:04He probably felt bad about not having a gift.
00:13:06Don't worry, you'll meet him later.
00:13:10Right.
00:13:12You know, I have some work that I could get done.
00:13:16All uber home.
00:13:36Max, where did you go?
00:13:41Let's stop wasting our time.
00:13:43We agreed to give it a month.
00:13:45No need. I already hired a very good investigator to find proof and later I'll find the lawyer for a divorce.
00:13:50Oh, Jesus.
00:13:51He said he'll meet you later after better preparation.
00:14:03I hope you don't blame him for leaving without notice four years ago.
00:14:07No, Emma, I understand that it's a difficult situation.
00:14:12Tomorrow there's an important charity event. Make sure you go. I'll take care of the rest.
00:14:17A charity event.
00:14:19Okay.
00:14:22Henry, tomorrow's charity event. Make sure Max goes, okay?
00:14:27Why don't you tell him directly?
00:14:29I don't want him to suspect anything.
00:14:32His sweet wife, Allie, will be there too.
00:14:36I must make sure he doesn't run away this time.
00:14:41I see. Wait. His wife's name is Allie? Does she happen to work in a law firm?
00:14:48Yes, why?
00:14:49I gotta go now.
00:14:52Wait!
00:14:55Wait!
00:14:57Arrange to donate in Alice's name at the charity dinner.
00:15:01Max likes girls who are passionate about meaningful social events. He may fall for her after that.
00:15:07Will the event be hosted under the name of Legend or Varigold Group?
00:15:11Legend Group. I want our new branch to build its reputation.
00:15:13Okay.
00:15:14Okay.
00:15:22Dude, let me ask. Are you sure about the divorce?
00:15:25Yes.
00:15:26How sure are you?
00:15:29A hundred percent sure. Why?
00:15:32Well, you better leave some room for more possibilities.
00:15:37Where'd you go earlier?
00:15:39Went back to visit the chairwoman.
00:15:40I see.
00:15:42So my mom's trying to get you to persuade me to give up on the divorce.
00:15:46That's right, but...
00:15:48Shut up.
00:15:50Hold on.
00:15:52Do you know who your wife is?
00:15:54I've heard enough about that one.
00:15:56Are you sure?
00:15:57You seemed interested in the investigator, but I actually found...
00:16:00Enough!
00:16:04What?
00:16:05And you're trying to just set me up, right?
00:16:07How much is my mom paying you?
00:16:09What?
00:16:10Come on!
00:16:12Please, okay? I need to focus on the Legend Group Charity Gala event.
00:16:16It's gonna be tomorrow.
00:16:19After that, we can talk about this whole so-called wife later.
00:16:23Max, there's something you really should know.
00:16:25No! Save it!
00:16:26Please.
00:16:28Enough.
00:16:37Boss, there's someone here to see you.
00:16:41Well, I don't have any meetings on today.
00:16:45When did you start scheduling my meetings, Henry?
00:16:48I just thought it was somebody that you'd like to see.
00:16:51I think she's outside. Hold on.
00:16:55Oh, hi, Alice.
00:16:58Oh, hi, Alice.
00:17:02Oh, hi, Alice.
00:17:05Um...
00:17:08What's up?
00:17:10What are you doing here?
00:17:12Henry said that you wanted to see me?
00:17:14Uh...
00:17:17Right. Of course.
00:17:20I just wanted to talk more about the case.
00:17:23Right.
00:17:25Yeah, I'm really sorry for leaving so abruptly earlier.
00:17:28Uh, no need to apologize.
00:17:30Actually, I had a question I wanted to ask you.
00:17:32Um, we're doing the Legend Group Charity Gal event tomorrow.
00:17:37Want to join me?
00:17:39You want me to join you?
00:17:41Oh, you want to make your wife jealous so she agrees to sign the divorce papers.
00:17:46Smart, uh, yeah.
00:17:48Yeah.
00:17:49Also, don't forget that I'm the victim here.
00:17:53This marriage is just a whole farce.
00:17:54What a coincidence. Emma also invited me.
00:18:07Alice.
00:18:09You look, uh, ravishing tonight.
00:18:11What the hell, Tom?
00:18:13What the hell, Tom?
00:18:17What the hell, Tom?
00:18:20Alice, how dare you seduce my husband?
00:18:23What are you talking about?
00:18:25How can someone like you attend such a high-class event anyway?
00:18:30Well, Linda, if someone like you can be here, I can definitely be here.
00:18:36I heard your husband left the country four years ago just to get away from you.
00:18:42How horrible is that?
00:18:45Actually, she's my wife.
00:18:50And I don't allow anyone to talk to my wife like that.
00:18:54You are?
00:18:56Show some respect or I'm going to call security.
00:18:59We all know Alice's husband fled the country four years ago just to get away from her.
00:19:04Yeah, well, he's back now.
00:19:08Tom, the CEO of Legend Group would like to meet with you at tonight's gala.
00:19:15I just got a call, and tonight I'm meeting a very important contact.
00:19:20Really, honey?
00:19:22Let's go.
00:19:24Let's not waste time on these low-class people.
00:19:26Thanks.
00:19:28Sure.
00:19:32All right, ladies and gentlemen, it is now time for tonight's main event.
00:19:47Tonight's winner who donates the most will receive a special collaboration opportunity with our sponsor, Legend Group.
00:19:57I heard the value of the collaboration is worth more than the top donation amount last year.
00:20:04So let's get it.
00:20:07I'll donate 10 million.
00:20:0910 million.
00:20:1150 million.
00:20:1350 million.
00:20:1560 million.
00:20:16100 million.
00:20:19100 million.
00:20:21Going once.
00:20:23Going twice.
00:20:24Oh, wow.
00:20:28Seems that a mysterious donor by the name of Alice just donated 200 million dollars.
00:20:35It wasn't me.
00:20:37It's just a coincidence, right?
00:20:42Alice?
00:20:43Alice?
00:20:45Alice?
00:20:46There is no way that the Alice who donated is this same Alice.
00:20:51Where would she get all that money, huh?
00:20:52Tell me.
00:20:53What kind of tricks are you guys trying to pull here?
00:20:56What are you doing to my boss?
00:20:59Henry, your boss?
00:21:01This is Max, the CEO of Legend Group.
00:21:04He's the important person I was going to introduce you to tonight.
00:21:07What?!
00:21:13Get better, Alice.
00:21:23Mom?
00:21:24Will you send me my wife's number?
00:21:26I'm confused.
00:21:30Oh, my head.
00:21:34Yeah, I think I have low blood sugar.
00:21:36Hey.
00:21:38Hey.
00:21:39I have something to eat.
00:21:40It's going to make you feel better.
00:21:41Oh.
00:21:48You know, I noticed that your husband didn't show up yet.
00:22:00How was your relationship with him, if you don't mind me asking?
00:22:05Actually, I do mind.
00:22:07I don't really want to talk about him.
00:22:10I understand.
00:22:11Hello?
00:22:27Hello?
00:22:32Hello?
00:22:35Who is this?
00:22:36Where's my wife?
00:22:38Hello?
00:22:39Who am I speaking to?
00:22:40Yes, I'm fine.
00:22:43I'll be okay.
00:22:44I just need to rest.
00:22:46Hello?
00:22:47She's probably speaking to her husband now.
00:22:49Hello?
00:22:50But I shouldn't inquire.
00:22:51Besides, I have my own problems to deal with.
00:22:53I love you too.
00:22:55Okay. Bye.
00:22:56Max.
00:22:57I checked the donation details.
00:22:58It's your wife who made the donation.
00:22:59Hmm.
00:23:00I see.
00:23:01I guess it can't be Alice Smith.
00:23:02There's no way she'd be able to afford it.
00:23:03Well, you know, there is another woman at the law firm named Ally.
00:23:04One of their high profile lawyers.
00:23:05I can look into her instead.
00:23:06Yeah.
00:23:07Yeah.
00:23:08Go do that.
00:23:09Who is that, babe?
00:23:10I don't know.
00:23:11Probably one of Alice's clients.
00:23:12Who is that, babe?
00:23:13I don't know.
00:23:14Probably one of Alice's clients.
00:23:15I'm surprised she hasn't realized yet because she left her work phone in your office.
00:23:16Okay.
00:23:17Forget about her.
00:23:18Steven.
00:23:19You said you would divorce your wife by now.
00:23:20How long are you going to keep me waiting?
00:23:21Okay.
00:23:22Okay.
00:23:23Okay.
00:23:24Okay.
00:23:25Okay.
00:23:26Okay.
00:23:27Okay.
00:23:28Okay.
00:23:29Okay.
00:23:30Okay.
00:23:31Okay.
00:23:32Okay.
00:23:33Okay.
00:23:34Okay.
00:23:35Okay.
00:23:36Okay.
00:23:37Okay.
00:23:38Okay.
00:23:39Okay.
00:23:40Okay.
00:23:41Okay.
00:23:42Okay.
00:23:43Okay.
00:23:44Okay.
00:23:45I'll settle things with her tonight.
00:24:03Hello?
00:24:04Hey.
00:24:05Well, we haven't seen each other in four years.
00:24:07I bet we can get a divorce.
00:24:08How about I give you $10 million?
00:24:10Is this Alice's husband?
00:24:12The one she's never even met?
00:24:13Wow.
00:24:14He's rich.
00:24:15Let me see what I can get out of this.
00:24:17What?
00:24:18Aw.
00:24:19Okay.
00:24:20I understand.
00:24:21Why don't we meet and talk?
00:24:23Good.
00:24:24I got a place in mind.
00:24:25Can we see what she wants?
00:24:26Put it on her.
00:24:27What?
00:24:28What?
00:24:29What that means?
00:24:30What?
00:24:31What?
00:24:32What's it going to do?
00:24:33Would you believe it Alice?
00:24:35I thought that my wife is cheating on me.
00:24:37I need to go and sort this out.
00:24:39Would you come with me?
00:24:41Yeah, sure.
00:24:42But don't say too much.
00:24:44Okay.
00:24:45Let's remember, let her speak first.
00:24:48Let her speak first.
00:24:55Allie?
00:25:04Oh, so I guess you're investigating me now.
00:25:07Wait, you two know each other?
00:25:09Yeah, we work at the same law firm.
00:25:18What are you looking at?
00:25:20Is that limited edition? I think I saw it in a magazine.
00:25:25Let's get to the point.
00:25:28I don't want a divorce unless you pay me enough.
00:25:30Okay, well, is ten million enough?
00:25:32That's not even enough to pay for your watch.
00:25:38Okay. How much is enough?
00:25:42Let me think.
00:25:50Okay, while you're thinking about that, why don't you go figure out a number, and then you can come back.
00:25:55For now, I need to talk with Alice.
00:26:00Okay.
00:26:12Max, I'm really sorry that you're going through this.
00:26:14I mean, Allie is clearly using your own emotions to extort you.
00:26:19Well, you know, it's like you said, Alice.
00:26:22An unhappy marriage is a grave.
00:26:26I'm just really happy that you're here.
00:26:28Thanks.
00:26:28Of course.
00:26:29Actually, I got you something.
00:26:38Wow.
00:26:44Max, I can't accept this.
00:26:45This is too nice.
00:26:48No, no.
00:26:49Please, I insist, okay?
00:26:51It's just a gift from a friend.
00:26:55Thanks.
00:26:55Oh, Alice.
00:27:07This is Mr. Roberts.
00:27:09He's the manager of the cafe.
00:27:10Mr. Roberts, Alice, she's been a great help to me lately.
00:27:13Hello, Alice.
00:27:13Lovely to meet you.
00:27:15Sorry, I actually have to take this.
00:27:18What a strange way for Max to introduce his wife.
00:27:21Would you like to order now, Mr. Brown, or should we wait for your wife?
00:27:25Please.
00:27:25Not just any woman, it's my wife.
00:27:27Oh, I see.
00:27:28They must have had a fight.
00:27:30Perhaps it was something to do with that other woman.
00:27:32Very well.
00:27:33I shall await for the lady.
00:27:37Hey, Emma.
00:27:38Alice, did Max call you?
00:27:40He said he's been trying to reach you.
00:27:42No, he hasn't called, actually.
00:27:45Oh, you know what?
00:27:46I think I gave you my work phone number.
00:27:48I don't check that one as often.
00:27:50Oh, that's a relief.
00:27:51I was worried.
00:27:53Emma, can you send me Max's number again?
00:27:55Okay.
00:27:56Great.
00:27:57Thanks.
00:28:04Okay, Mom.
00:28:05Hi.
00:28:06I'm going through with the divorce.
00:28:07Please, I think that woman was a gold digger.
00:28:09No way!
00:28:10She's not that kind of woman.
00:28:12Are you meeting with someone new?
00:28:17Yes.
00:28:17Yes, actually, I am.
00:28:19And she's kind.
00:28:20She's got this grace about her.
00:28:24Sorry, I've got to go.
00:28:25Mom, I'll call you later.
00:28:29I didn't mean for you to overhear that.
00:28:31Sorry.
00:28:32I didn't realize you were there.
00:28:34That's okay.
00:28:36I'm glad you think so highly of me.
00:28:39I do.
00:28:42I mean, I really do.
00:28:43I do.
00:28:47I do.
00:28:47I do.
00:28:50I do.
00:28:51I do.
00:28:52I do.
00:28:53I do.
00:28:53I do.
00:28:54I don't mind.
00:28:55I do.
00:28:56It matters.
00:28:57I do.
00:28:57There's you.
00:29:05So, Cousin Max, you have got to tell me all about what you've been up to down under.
00:29:12A little thunder from down under, I expect.
00:29:16Well, it isn't a short story I could tell you that much, Mike.
00:29:20But first, since when did you get back from the UK?
00:29:24Oh, I just got back.
00:29:26Yeah, right after my parents divorced.
00:29:30Sorry, boss, it's time to go.
00:29:42Why give a shit about him?
00:29:45Remember how his dad tried to steal power from your father?
00:29:48Yeah, but at the end of the day, we're all family.
00:29:50I heard it was all his idea, and he's the one who controls his father.
00:29:55Be careful.
00:29:56Henry, don't worry about it, okay?
00:30:01What's the worst thing you could do?
00:30:02Max, it's Alice. Can we talk?
00:30:20Alice?
00:30:22Max's wife.
00:30:23It's about us.
00:30:25Emma said that we should talk.
00:30:26Yes. I have been looking forward to seeing you two.
00:30:36It's about us. Emma said that we should talk.
00:30:41I have been looking forward to seeing you two.
00:30:44Really? I thought you'd hate to see me.
00:30:46No. No way.
00:30:48Say, why don't we meet up sometime next week?
00:30:53Okay. Let's do it.
00:30:55Great.
00:30:56Oh, and Alice, I don't use this phone often.
00:31:02Let me give you my main number.
00:31:03No problem.
00:31:14Hmm.
00:31:16I knew you'd come back for his phone.
00:31:27Max, I have something for you.
00:31:31The woman you said you met yesterday, she sounded different than I expected, so I did some digging.
00:31:35I can't believe my mother still likes this woman.
00:31:39I'm sorry, Max. The evidence is undeniable.
00:31:42She did have an affair with her boss.
00:31:43We need to handle this carefully.
00:31:48Henry, I want you to follow up on this information, and I need you to keep this information under wraps.
00:31:52This is strictly family matter.
00:31:54Understood. I'll do everything I can to uncover the truth.
00:31:57Thanks, Henry.
00:31:57No, I'm really, really looking forward to seeing you. It's been so long.
00:32:07I can't wait either.
00:32:11And Emma said that you're planning the wedding, right?
00:32:14Yes. And I never stopped thinking about you, Alice.
00:32:18Why don't we just meet today?
00:32:20I'm at Greensdale Mall right now.
00:32:23That sounds great. I'll be there as soon as I can.
00:32:26Great.
00:32:29So many years have passed, Max. I'm so happy I found you again.
00:32:37Alice?
00:32:39Max!
00:32:41What are you doing here? You shopping for a hot date?
00:32:44As a matter of fact, yes. I am.
00:32:48Huh. Well, I hope he's worthy of you.
00:32:52I think so.
00:32:53You know what?
00:32:55I got a card for this mall.
00:32:57Take it.
00:32:58Use it for whatever you want.
00:33:00No. I can't do that.
00:33:02Please.
00:33:03For all the help that you gave me?
00:33:08Okay.
00:33:12Sure.
00:33:12Alice?
00:33:27What are you doing here?
00:33:29I'm shopping, Linda.
00:33:30What does it look like?
00:33:31Shopping.
00:33:33Of course.
00:33:33And I'm sure the only thing you can afford here
00:33:36is that iced coffee.
00:33:42Mix your bags, miss.
00:33:44When you're ready, please pay with the card.
00:33:47Thank you, Lucy.
00:33:48What?
00:33:51Thank you, Lucy.
00:33:52What?
00:33:54Hold on. Hold on.
00:33:55You can't afford this.
00:33:59Oh.
00:34:00Yes, I can.
00:34:02These are designer.
00:34:05And?
00:34:07Whatever.
00:34:08Just don't ask me to cover you later.
00:34:11You know, actually, Linda,
00:34:14I bet you couldn't afford these.
00:34:16You don't think I can?
00:34:20Please.
00:34:21Please.
00:34:25And here's your receipt
00:34:28for $19,999.
00:34:31I'm sorry, how much?
00:34:43$20,000?
00:34:45Linda, what the hell did you buy?
00:34:47Tom, it's...
00:34:47It's just the shopping bill.
00:34:51Yes, it's a lot, but
00:34:52I had to save face.
00:34:54Stay where you are.
00:34:55I'm coming to find you.
00:35:00Linda, what's the meaning behind this?
00:35:03It's all a trick, babe.
00:35:04She made me pay for it.
00:35:06Excuse me?
00:35:07Alice,
00:35:09you conned Linda
00:35:10into paying for your shit?
00:35:11I didn't con anyone, okay?
00:35:13She paid before I had the chance to.
00:35:15You scam artist!
00:35:17Well, I want my money back.
00:35:22Don't you touch her.
00:35:24Who the hell are you?
00:35:28I'm her husband.
00:35:31Now back off
00:35:32if you don't want any trouble.
00:35:33I should have been here sooner.
00:35:50Alice, I'm sorry.
00:35:51I'm so sorry I left you four years ago.
00:35:55I've...
00:35:56I've really been regretting it every day since.
00:35:58Alice.
00:35:59It's okay.
00:36:01I'm just glad you're here now.
00:36:08Alice?
00:36:10That's probably her husband.
00:36:12I'll leave her be.
00:36:13I'll leave her be.
00:36:13Come on in.
00:36:27Max, why don't you live at home?
00:36:29Well, I, um...
00:36:31I've tried out a lot for work lately.
00:36:32I...
00:36:33I guess I just...
00:36:37I'm not used to hotels.
00:36:42It's...
00:36:42cozy.
00:36:44I do try to make you like coffee.
00:36:49Oh!
00:36:50Alice, I'm so sorry.
00:36:53Let me help.
00:36:54I'm fine.
00:36:57Seeing as we barely know each other,
00:36:59I think I need more time.
00:37:07Alice.
00:37:12Alice.
00:37:14Alice, Alice, Alice.
00:37:17Are you playing hard to get?
00:37:20Yes.
00:37:20Did you see?
00:37:29Hi, um...
00:37:30Can I get a towel?
00:37:31Please?
00:37:35Alice!
00:37:38Max!
00:37:40Hi.
00:37:41Oh!
00:37:45Max, what are you doing here?
00:37:48Alice, it is so good to see you.
00:37:52You're drunk.
00:37:54Mm-mm.
00:37:55It must be because of his wife.
00:37:57Let's get you home.
00:38:00Come on.
00:38:01I'll take you.
00:38:04Oh.
00:38:05Careful.
00:38:06Just...
00:38:07Go this way.
00:38:08And then we're gonna go to your room.
00:38:10Here.
00:38:10Careful, careful, careful.
00:38:11Oh.
00:38:15Alice.
00:38:18Matt, we shouldn't...
00:38:20I know.
00:38:23But I missed you.
00:38:27What am I doing?
00:38:39Why do I like him more than my own husband?
00:38:48Max, I saw your wife with another man.
00:38:50She went into a hotel and...
00:38:51Oh, I, uh...
00:38:55Didn't realize you were with Alice.
00:39:02What's going on, Henry?
00:39:04I saw Max's wife.
00:39:07I thought you should know.
00:39:08So she is cheating on him.
00:39:11Yeah.
00:39:12She's arrogant enough to cheat during the divorce.
00:39:19I should go.
00:39:19Wait, Alice.
00:39:22I'm sorry for the intrusion.
00:39:25Alice, please.
00:39:26Don't go.
00:39:33Oranges?
00:39:34Actually, that's not me.
00:39:35That's at the house in the country.
00:39:38How about this?
00:39:39Max and Alice.
00:39:40Two hearts yearning for love.
00:39:43If only they knew how perfect they are for each other.
00:39:45I wouldn't be able to do this without you.
00:39:49Alice, I need to ask you something.
00:39:55It's about Max.
00:39:57Yeah.
00:39:58What is it?
00:39:59I see how you two could be happy together.
00:40:02Help him get the divorce soon and do it for the both of you.
00:40:07I have a husband.
00:40:09He has a wife.
00:40:10I'm here on a job.
00:40:11To help him get a divorce, I...
00:40:13Henry, please don't suggest something like that again.
00:40:16Let's just keep this professional.
00:40:26Allie.
00:40:28This is for the exceptional job you did last night.
00:40:31It is truly well-deserved.
00:40:33I love it.
00:40:35Put it on me.
00:40:36Okay.
00:40:45And...
00:40:46This is ready.
00:40:50Now I have all I need.
00:40:52We're going to get a lot of money.
00:40:54A lot.
00:40:55We're going to be richie.
00:41:06Uh...
00:41:06Hi...
00:41:08Um...
00:41:09I'm sorry.
00:41:10I didn't mean to interrupt.
00:41:12You weren't interrupting.
00:41:14We were just...
00:41:15Um...
00:41:16Actually, I'm here on business.
00:41:20As you know, Max commissioned me to handle his divorce file.
00:41:24Oh, well, he should give me what I asked for.
00:41:28According to the terms, I am entitled to half his property.
00:41:31If this divorce goes public, his company's stock will tank, and we'll see who loses out then.
00:41:38I understand your position, Allie, but Max is firm on this, and he's willing to fight for what's right.
00:41:44Also, he knows about the affair you're having.
00:41:46Um...
00:41:54Hello, I'm...
00:41:55I need to file a divorce case.
00:41:59Sorry, I don't take cheap cases like yours.
00:42:03But I need help.
00:42:05I handle high-profile cases, not common ones.
00:42:11I can help you.
00:42:13Thank you so much.
00:42:14Uh, I'm Alice.
00:42:15What's your name?
00:42:16Mr. Thompson Brown.
00:42:17I'm one of the board members at Legend Group.
00:42:25Lovely to meet you.
00:42:26Good to meet you.
00:42:27Mr. Brown, I apologize for any misunderstanding.
00:42:30Allie doesn't normally act like this.
00:42:32I came here to assess if your firm was worthy of our business.
00:42:38I didn't expect to be met with such arrogance.
00:42:41Especially from a lawyer.
00:42:42Mr. Brown.
00:42:43Enough, Allie!
00:42:43You've made a grave error in judgment.
00:42:45You need to apologize to Mr. Brown right now!
00:42:49You may be the board member of the Legend Group, but I am the wife of the CEO, so why should
00:42:54I give a shit about you?
00:42:56Wow.
00:42:57I'll show you what I can do.
00:42:58Just you wait.
00:43:00Please!
00:43:03I've decided that in the future, I will seek your services alone.
00:43:07Not this law firm.
00:43:07Not this law firm, but you alone.
00:43:12Actually, I'm not a lawyer.
00:43:13I'm just a marriage investigator.
00:43:15That's quite all right.
00:43:16I'm sure you'll get along great with our lawyers.
00:43:17You have made good progress on this case, Alice.
00:43:29I'm impressed.
00:43:31I apologize if I'm overstepping here, but I was wondering if you'd be interested in meeting
00:43:39my son, Michael.
00:43:40He's a fine young man.
00:43:42Well, I heard what you were about to suggest, Thompson.
00:43:45Listen, I must advise against it.
00:43:49Allie is married, and your son is not the type of person she should be involved with
00:43:55anyway.
00:43:59I assure you, Michael is a gentleman that would treat Alice with the utmost respect.
00:44:04I suggest only an introduction.
00:44:05Strictly professional.
00:44:06I know my daughter-in-law's value, and I won't have her entangled in your son's affairs.
00:44:13Allie, we should go.
00:44:21Thank you, Mr. Brown.
00:44:22I really appreciate the consideration, but I really should respect my mother-in-law's wishes.
00:44:28Of course, Alice.
00:44:36A missed opportunity, indeed.
00:44:39Allie, there are things about our family that you don't know, especially Mr. Brown and
00:44:46his son, Michael.
00:44:49He's not a good man.
00:44:52Why?
00:44:53What makes you say that?
00:44:59Michael went abroad after failing to seize control of family business.
00:45:03But now that he's back, he's looking to expand his reach.
00:45:08And your connection to Max makes you a valuable pawn in his games.
00:45:18That's awful.
00:45:20I refuse to be taken advantage of.
00:45:22I really thought Mr. Brown was different.
00:45:27Guess I was wrong.
00:45:28Thank you, Emma.
00:45:31Stay vigilant, Allie.
00:45:34Now, tonight, dress well.
00:45:38I've arranged a special family dinner for us.
00:45:43And Max will be there, too.
00:45:46Okay.
00:45:48I'll be there.
00:45:49Thank you, Emma.
00:45:52So, Allie, have you had a chance to meet with Max yet?
00:46:01Yes, we've met.
00:46:03He's been very...
00:46:04enthusiastic.
00:46:07Well, that's good to hear.
00:46:09It's important that our family is united.
00:46:13Right.
00:46:14Yes.
00:46:18What?
00:46:19The warehouse is on fire?
00:46:21Shit!
00:46:24I need to go.
00:46:25You stay here and wait for Max, okay?
00:46:27Okay.
00:46:29God.
00:46:33What is this traffic, Henry?
00:46:34We've been sitting here for like 15 minutes.
00:46:37You know what?
00:46:38I'm going to walk the rest.
00:46:39I'll see you there.
00:46:43Guess it's just me.
00:46:46Alice!
00:46:48Oh, Max!
00:46:49Max!
00:46:51I was beginning to think you got lost.
00:46:59Not at all.
00:47:01It's lovely to see you.
00:47:03I hope I haven't been keeping you waiting.
00:47:05No, no.
00:47:06You haven't.
00:47:07It's nice to see you, too.
00:47:09And I'm sorry about the other night.
00:47:13It's okay.
00:47:15It wasn't your fault.
00:47:16Besides, that's why my mother gave us a chance to get to know each other more, right?
00:47:21Yeah.
00:47:22Thank you for making this work.
00:47:25Sure.
00:47:26Um, what should we have?
00:47:31I'll tell you what.
00:47:32Let's enjoy a drink and then get out of here.
00:47:35There's something I want to show you.
00:47:39Okay.
00:47:40Great.
00:47:41Okay.
00:47:46Mom, where are you?
00:48:00I can't seem to find you or Allie.
00:48:02I'm dealing with the warehouse.
00:48:04She might have left.
00:48:05Next time, then.
00:48:07Ah, I see.
00:48:08Well, it's probably for the best.
00:48:12I wasn't really in the mood to see her tonight anyway.
00:48:14Okay.
00:48:16Well, I thought we could have our own private dinner here.
00:48:28What do you think?
00:48:31It's beautiful, Max.
00:48:34Um, but why do you keep bringing me to hotels?
00:48:38Um, Alice, I understand that the last time wasn't the right time.
00:48:46Um, seeing as I hadn't proposed to you yet.
00:48:52So, will you marry me?
00:48:56Max, um, this is all really sudden.
00:49:00I need time.
00:49:03Of course.
00:49:04But, uh, know that my feelings for you are genuine.
00:49:15I know this is really frustrating for you.
00:49:18I want you to know that I really do want to make this work between us.
00:49:21What the fuck was that, huh?
00:49:47I don't understand you.
00:49:50You left.
00:49:53You left your stuff here.
00:49:56To seduce me.
00:49:58Didn't you?
00:49:59Huh?
00:50:01Didn't you?
00:50:04You're nothing like what I imagined, Max.
00:50:06I, I need time.
00:50:08I, I can't force myself.
00:50:10I'm sorry.
00:50:11Shut your mouth.
00:50:13Just say your lies.
00:50:15Okay?
00:50:16All you women are exactly the same.
00:50:20Now, I can finish.
00:50:23You're starting.
00:50:27Never.
00:50:28You weren't like this before.
00:50:29You fucking bitch.
00:50:32You can't escape me, Alice.
00:50:37I can't do this, anyone.
00:50:46I want a divorce.
00:50:49Ellie, are you sure?
00:50:51You were once so confident.
00:50:53Why can't you try and work things out?
00:50:58I just can't.
00:51:00The marriage isn't what I hoped for.
00:51:02Sorry, Emma.
00:51:03Yeah, I understand your feelings, but divorce is a serious step.
00:51:11Are you certain you can't find a way to cultivate these feelings again?
00:51:16No.
00:51:17I need to move on.
00:51:19For my own sake.
00:51:24You know what?
00:51:26Allie keeps going behind my back and sending dinners with my mom.
00:51:29I can't stand that one.
00:51:30You know, sometimes I think how nice it would be if I was married to a woman like Alice.
00:51:36You know, someone who understands me, who connects with me on a deeper level.
00:51:42You know what, man?
00:51:44Forget her.
00:51:46Alice is a great woman and all, but she's got a husband.
00:51:50And you have a wife.
00:51:52You need to face reality.
00:51:54Maybe it's time to end the charade.
00:52:11Hello, Mom.
00:52:13Max Alley has agreed to the divorce.
00:52:15It's going to be a clean break.
00:52:19Really?
00:52:19That's great news.
00:52:21How'd you get the gold?
00:52:22They're going to suddenly change her mind.
00:52:23She was never a gold digger, Max.
00:52:26I want you to know that.
00:52:28Yeah, yeah, yeah.
00:52:28Whatever you say, Mom.
00:52:31Penry, Allie finally decided for the divorce.
00:52:34What?
00:52:35That's unbelievable.
00:52:37Let's celebrate.
00:52:38Cheers, cheers.
00:52:39Ha ha.
00:52:46Mom.
00:52:47Mom along.
00:52:48Fuck, this woman is so annoying.
00:52:53She came to my mom's house.
00:52:55What are you doing here?
00:52:57I told you to leave me alone.
00:53:00I want to move on with my life.
00:53:02Have you no shame?
00:53:08I want to move on with my life.
00:53:10Yeah, you've got no shame?
00:53:14Because see, on the surface, it seemed like you were good with the divorce.
00:53:18And now you're here trying to seduce me.
00:53:20What are you talking about?
00:53:21I'm not trying to seduce you.
00:53:24I'm done with your lies.
00:53:27Not lying.
00:53:28I came here to rest.
00:53:29Emma said that I could rest here.
00:53:34Save it for someone who cares.
00:53:36I'm done with your games.
00:53:41I'm not playing any games, Max.
00:53:48That voice sounded different.
00:54:00Alice, do you know that we've lost every one of our clients because of you?
00:54:06No, you can blame Mr. Thompson-Brown for that.
00:54:10Actually, no, I would blame Allie for that.
00:54:13Hey, why don't you give me Max's divorce case?
00:54:16At least in my hands, I could save this law firm.
00:54:19Oh, you know, I highly doubt that.
00:54:21Plus, Max wouldn't agree to that.
00:54:24I already talked to him.
00:54:26And he already agreed.
00:54:29Well, if that's the case, then I'll wait for him to confirm it with me.
00:54:34Oh, Allie, have you seen my work phone anywhere?
00:54:39I must have missed like ten calls.
00:54:41Why don't you handle your own shit?
00:54:44Alice, my wife is someone that we cannot trust.
00:54:59Last night was just so disappointing.
00:55:01She came into my mom's home and she tried to seduce me.
00:55:05That's awful.
00:55:07I'm really sorry, Max.
00:55:08I have to ask you.
00:55:12Did you pass off the case to my boss, Stephen?
00:55:15No.
00:55:16No, why?
00:55:18No reason, I guess.
00:55:20They just wanted more information from you.
00:55:23I can't stand that woman.
00:55:25I mean, she probably got a certificate from the lawyers just to exploit me.
00:55:29I can't comment on that.
00:55:31But what I can say is that there are good lawyers and bad lawyers,
00:55:35and I would never do that to you.
00:55:38That woman is nothing compared to you, Alice.
00:55:45Max, I really don't want to hurt you.
00:55:49I can't be what you want me to be.
00:55:51Let's just try to finish this and move on with our lives amicably.
00:55:56I see.
00:56:12Alice, I've lost so much money, and my firm is dying because of you.
00:56:18If I can't be happy, neither can you.
00:56:21You're going to pay.
00:56:21Thanks for meeting me here again.
00:56:24Of course.
00:56:25You parked nearby?
00:56:26Oh, no.
00:56:27I was just going to...
00:56:28No, it's good.
00:56:29I'm parked right down this way.
00:56:31Alice!
00:56:31Max!
00:56:32Max!
00:56:33Max!
00:56:34Are you okay?
00:56:35Oh, my God.
00:56:36I'm going to call.
00:56:37Don't worry.
00:56:38Oh, my phone's broken.
00:56:39Okay, stay with me.
00:56:40Don't worry.
00:56:41Okay, stay with me.
00:56:42Stay with me.
00:56:43Stay with me.
00:56:44Max!
00:56:45Max!
00:56:46Max, are you okay?
00:56:47Oh, my God.
00:56:48I'm going to call.
00:56:49Don't worry.
00:56:50Oh, my phone's broken.
00:56:51Okay, stay with me.
00:56:52Don't worry.
00:56:53Okay, stay with me.
00:56:54Stay with me.
00:56:55Max!
00:57:02Alice?
00:57:04Max!
00:57:06You're awake.
00:57:08How do you feel?
00:57:09Oh, Crocky.
00:57:13What happened?
00:57:14You were in an accident.
00:57:16You need to thank your wife, who carries you two blocks to get help.
00:57:22You did that for me?
00:57:24You saved me, too.
00:57:26It's just a mild concussion from the crash.
00:57:29You may experience symptoms such as headaches, dizziness, and some memory loss, but this is all normal.
00:57:36You hear that, Alice?
00:57:40I got a concussion.
00:57:42Might be a little bit slow and stupid for the rest of my life.
00:57:45Is that so?
00:57:47Yeah.
00:57:48I might need you to take care of me.
00:57:52Well, if that's the case, then I will.
00:57:54Don't you worry. This accident will not influence your BANG sex life or make you an idiot.
00:58:06Actually, he's not my husband.
00:58:09Oh, pardon me.
00:58:10Me?
00:58:16Sir!
00:58:17I've looked into the car accident.
00:58:19We've managed to identify the car, but the police haven't found the driver yet.
00:58:22Keep on it, Henry. I'm going to need you to look in to find out who did this.
00:58:25Of course, sir.
00:58:26Hello?
00:58:27Max, if you introduce me as the CEO's wife and board member at the upcoming business dinner,
00:58:42plus give me $20 million, I promise to divorce you.
00:58:45Fine.
00:58:46But this is going to be the last favor.
00:58:55Pleasure meeting you.
00:58:57This is my wife, Allie.
00:58:58She's the CEO of Legend Group, and she's the woman, the chairwoman of the whole board.
00:59:03Pleasure to meet you.
00:59:06Allie, could you tell us about your company's current investment strategy?
00:59:13Well...
00:59:14It's...
00:59:15Or you could tell us anything at all.
00:59:18About the company.
00:59:20Yeah.
00:59:22If you don't have anything to say about that,
00:59:25maybe you have something to say about this.
00:59:28It wasn't just me.
00:59:30It was Allie, who asked me to hit Allison next.
00:59:35No?
00:59:36I had nothing to do with that.
00:59:38That's defamation.
00:59:40I...
00:59:41Why are you looking at me?
00:59:42It wasn't me.
00:59:43Henry?
00:59:44I...
00:59:45I swear!
00:59:46I...
00:59:47That wasn't...
00:59:48You guys!
00:59:49I'm being saved!
00:59:50Let me go!
00:59:51Let me go!
00:59:52No!
00:59:55Alice.
00:59:56I have something for you.
00:59:58The police recovered it from Allie.
01:00:00Here you go.
01:00:02My work phone.
01:00:03I've been looking everywhere for this.
01:00:05What are all these missed calls?
01:00:07Was Allie using my phone to call Max?
01:00:14Hello?
01:00:15Hello?
01:00:17Hold on.
01:00:18Wait.
01:00:20It's you!
01:00:21It's you!
01:00:24Why are you calling from her phone?
01:00:26I have something to tell you.
01:00:27Meet me at Moonfall Lodge restaurant.
01:00:38Hey.
01:00:39Boss.
01:00:41I found out the truth about your wife.
01:00:43Henry.
01:00:44Please.
01:00:45Not now.
01:00:46I'm supposed to be meeting Alice here.
01:00:47Actually, sir, you're going to want to look at this and you should cherish her.
01:00:54Do not mention this woman to me again.
01:00:57The woman I care about is Alice.
01:00:59You should know that by now, alright?
01:01:02I can't believe I'm still tied to this woman.
01:01:13Alice?
01:01:14Alice.
01:01:17Not Allie?
01:01:20Alice Smith is the woman I married, not Allie?
01:01:25Alice.
01:01:27Alice is my wife.
01:01:29Alice Smith.
01:01:31The woman I married, the name is Taylor.
01:01:35It should be Allie Taylor.
01:01:37She used her mother's last name after she lost her father.
01:01:40And your wife's first name isn't Allie.
01:01:42It's Alice.
01:01:44And also, she was in your class in college, but you never paid attention to her.
01:01:48You've known her for a long time.
01:01:50It's really you.
01:01:51It's really you.
01:01:52It's really you.
01:01:53It's really you.
01:01:54It's really you.
01:01:55It's really you.
01:01:56It's really you.
01:01:57It's really you.
01:01:58It's really you.
01:01:59It's really you.
01:02:00It's really you.
01:02:01It's really you.
01:02:02It's really you.
01:02:03It's really you.
01:02:04It's really you.
01:02:08It's just acatacactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactact
Be the first to comment
Add your comment